Sample Chapter

INSTANT DOWNLOAD

 

Lehninger Principles Of Biochemistry 5th edition By Albert L. Lehninger – Test Bank 

 

Chapter 1   The Foundations of Biochemistry

 

 

 

Multiple Choice Questions

 

  1. Cellular foundations

Pages: 2-4            

In a bacterial cell, the DNA is in the:

 

  1. cell envelope.
  2. cell membrane.

 

  1. Cellular foundations
Page: 3

A major change occurring in the evolution of eukaryotes from prokaryotes was the development of:

 

  1. photosynthetic capability.
  2. plasma membranes.
  3. the nucleus.

 

  1. Cellular foundations

Page: 3                 

In eukaryotes, the nucleus is enclosed by a double membrane called the:

 

  1. cell membrane.
  2. nuclear envelope.

 

  1. Cellular foundations

Page: 4                 

The dimensions of living cells are limited, on the lower end by the minimum number of biomolecules necessary for function, and on the upper end by the rate of diffusion of solutes such as oxygen. Except for highly elongated cells, they usually have lengths and diameters in the range of:

 

  1. 1 mm to 10 mm.
  2. 3 mm to 30 mm.
  3. 3 mm to 100 mm.
  4. 1 mm to 100 m
  5. 1 mm to 300 m

 

 

 

  1. Cellular foundations

Page: 4                 

Which group of single-celled micro-organisms has many members found growing in extreme environments?

 

  1. none of the above.

 

  1. Cellular foundations

Page: 5                 

The bacterium E. coli requires simple organic molecules for growth and energy—it is therefore a:

 

 

  1. Cellular foundations

Page: 6-8              

Which one of the following has the cellular components arranged in order of increasing size?

 

  1. Amino acid < protein < mitochondrion < ribosome
  2. Amino acid < protein < ribosome < mitochondrion
  3. Amino acid < ribosome < protein < mitochondrion
  4. Protein < amino acid < mitochondrion < ribosome
  5. Protein < ribosome < mitochondrion < amino acid

 

  1. Cellular foundations

Page: 10               

The three-dimensional structure of macromolecules is formed and maintained primarily through noncovalent interactions.  Which one of the following is not considered a noncovalent interaction?

 

  1. carbon-carbon bonds
  2. hydrogen bonds
  3. hydrophobic interactions
  4. ionic interactions
  5. van der Waals interactions

 

  1. Chemical foundations

Page: 11               

Which one of the following is not among the four most abundant elements in living organisms?

 

  1. Carbon
  2. Hydrogen
  3. Nitrogen
  4. Oxygen
  5. Phosphorus

 

  1. Chemical foundations

Page: 12-13                      

The four covalent bonds in methane (CH4) are arranged around carbon to give which one of the following geometries?

 

  1. linear
  2. tetrahedral
  3. trigonal bipyramidal
  4. trigonal planar
  5. trigonal pyramidal

 

  1. Chemical foundations
Page: 12

What functional groups are present on this molecule?

 

 

  1. ether and aldehyde
  2. hydroxyl and aldehyde
  3. hydroxyl and carboxylic acid
  4. hydroxyl and ester
  5. hydroxyl and ketone

 

  1. Chemical foundations

Page: 14

The macromolecules that serve in the storage and transmission of genetic information are:

 

  1. nucleic acids.

 

  1. Chemical foundations

Page: 16               

Stereoisomers that are nonsuperimposable mirror images of each other are known as:

 

  1. cis-trans isomers.
  2. geometric isomers.

 

  1. Chemical foundations

Page: 18

The enzyme fumarase catalyzes the reversible hydration of fumaric acid to l-malate, but it will not catalyze the hydration of maleic acid, the cis isomer of fumaric acid.  This is an example of:

 

  1. biological activity.
  2. chiral activity.

 

  1. Physical foundations

Page: 20               

Humans maintain a nearly constant level of hemoglobin by continually synthesizing and degrading it.  This is an example of a(n):

 

  1. dynamic steady state.
  2. equilibrium state.
  3. exergonic change.
  4. free-energy change.
  5. waste of energy.

 

  1. Physical foundations

Page: 22

If heat energy is absorbed by the system during a chemical reaction, the reaction is said to be:

 

  1. at equilibrium.

 

  1. Physical foundations

Page: 22               

If the free energy change DG for a reaction is -46.11 kJ/mol, the reaction is:

 

  1. at equilibrium.

 

  1. Physical foundations

Page: 23               

The major carrier of chemical energy in all cells is:

 

  1. acetyl triphosphate.
  2. adenosine monophosphate.
  3. adenosine triphosphate.
  4. cytosine tetraphosphate.
  5. uridine diphosphate.

 

  1. Physical foundations

Page: 25               

Enzymes are biological catalysts that enhance the rate of a reaction by:

 

  1. decreasing the activation energy.
  2. decreasing the amount of free energy released.
  3. increasing the activation energy.
  4. increasing the amount of free energy released.
  5. increasing the energy of the transition state.

 

  1. Physical foundations

Page: 25               

Energy requiring metabolic pathways that yield complex molecules from simpler precursors are:

 

 

  1. Genetic foundations

Page: 27               

Hereditary information (with the exception of some viruses) is preserved in:

 

  1. deoxyribonucleic acid.
  2. membrane structures.
  3. ribonucleic acid.

 

  1. Genetic foundations

Page: 28               

When a region of DNA must be repaired by removing and replacing some of the nucleotides, what ensures that the new nucleotides are in the correct sequence?

 

  1. DNA cannot be repaired and this explains why mutations occur.
  2. Specific enzymes bind the correct nucleotides.
  3. The new nucleotides basepair accurately with those on the complementary strand.
  4. The repair enzyme recognizes the removed nucleotide and brings in an identical one to replace it.
  5. The three-dimensional structure determines the order of nucleotides.

 

  1. Genetic foundations

Page: 29               

The three-dimensional structure of a protein is determined primarily by:

 

  1. electrostatic guidance from nucleic acid structure.
  2. how many amino acids are in the protein.
  3. hydrophobic interaction with lipids that provide a folding framework.
  4. modification during interactions with ribosomes.
  5. the sequence of amino acids in the protein.

 

  1. Evolutionary foundations

Pages: 30-31                    

According to Oparin’s theory for the origin of life, the prebiotic atmosphere:

 

  1. already contained some primitive RNA molecules.
  2. basically was very similar to the atmosphere of today.
  3. contained many amino acids.
  4. had an abundance of methane, ammonia, and water.
  5. was rich in oxygen.

 

Short Answer Questions

 

  1. Cellular foundations

Pages: 1-2

What six characteristics distinguish living organisms from inanimate objects?

 

 

  1. Cellular foundations

Page: 3     

All cells are surrounded by a plasma membrane composed of lipid and protein molecules.  What is the function of the plasma membrane?

 

 

  1. Cellular foundations

Page: 5     

  1. coli is known as a gram-negative bacterial species. (a) How is this determined? (b) How do gram-negative bacteria differ structurally from gram-positive bacteria?

 

 

  1. Cellular foundations

Page: 6     

Most cells of higher plants have a cell wall outside the plasma membrane.  What is the function of the cell wall?

 

 

  1. Cellular foundations

Page: 10   

  • List the types of noncovalent interactions that are important in providing stability to the three-dimensional structures of macromolecules. (b) Why is it important that these interactions be noncovalent, rather than covalent, bonds?

 

 

  1. Chemical foundations

Page: 12               

Draw the structures of the following functional groups in their un-ionized forms:

  • hydroxyl, (b) carboxyl, (c) amino, (d) phosphoryl.

 

 

 

  1. Chemical foundations

Pages: 13-14        

What is the underlying, organizing biochemical principle that results in the chemical similarity of virtually all living things?  Given this biochemical similarity, how is the structural and functional diversity of living things possible?

 

  1. Chemical foundations

Page: 14   

Name two functions of (a) proteins, (b) nucleic acids, (c) polysaccharides, (d) lipids.

 

 

  1. Chemical Foundations

Page: 16   

Why is an asymmetric carbon atom called a chiral center?

 

 

  1. Chemical foundations

Pages: 15-16, 18  

Differentiate between configuration and conformation.

 

 

  1. Chemical foundations

Pages: 16-17        

  • What is optical activity? (b) How did Louis Pasteur arrive at an explanation for the phenomenon of optical activity?

 

 

  1. Chemical foundations

Pages: 18-19        

A chemist working in a pharmaceutical lab synthesized a new drug as a racemic mixture.  Why is it important that she separate the two enantiomers and test each for its biological activity?

 

  1. Chemical foundations

Page: 18   

Explain why living organisms are able to produce particular chiral forms of different biomolceules while laboratory chemical synthesis usually produces a racemic mixture.

 

 

  1. Physical foundations

Page: 20   

Proteins are constantly being synthesized in a living cell.  Why doesn’t the number of protein molecules become too great for the cell to contain, leading to cell destruction?

 

 

  1. Physical foundations

Page: 20   

Describe the relationship between a living organism and its surroundings in terms of both matter and energy.

 

 

  1. Physical foundations

Page: 22-24          

The free-energy change for the formation of a protein from the individual amino acids is positive and is thus an endergonic reaction. How, then, do cells accomplish this process?

 

 

  1. Physical foundations

Pages: 22-24        

Instant cold packs get cold when the contents, usually solid urea and liquid water, are mixed, producing an aqueous solution of urea.  Although this process is clearly spontaneous, the products are colder than the reactants.  Explain how this is possible in terms of the difference between DG and DH.

 

 

  1. Physical foundations

Pages: 24-25        

(a) On the reaction coordinate diagram shown below, label the transition state and the overall free-energy change (DG) for the uncatalyzed reaction A ® B.  (b) Is this an exergonic or endergonic reaction?  (c) Draw a second curve showing the energetics of the reaction if it were enzyme-catalyzed.

 

 

 

 

  1. Physical foundations

Page: 26   

What is meant by feedback inhibition and why is it important in a living organism?

 

 

  1. Genetic foundations

Pages: 27-29        

How is the genetic information encoded in DNA and how is a new copy of DNA synthesized?

 

 

  1. Genetic foundations

Pages: 27-30        

Hereditary transmission of genetic information can be viewed as a balance between stability and change.  Explain.

 

 

  1. Genetic foundations

Pages: 29-30        

Discuss how a mutation in DNA could be harmful or beneficial to an organism.

 

 

  1. Evolutionary foundations

Pages: 30-31

Describe Stanley Miller’s experiment (1953) and its relevance.

 

 

  1. Evolutionary foundations

Pages: 31-32        

Describe the “RNA world” hypothesis.

 

 

  1. Evolutionary functions

Page: 32   

Describe how the rise of O2-producing bacteria might have led to the eventual predominance of aerobic organisms on earth.

 

 

 

  1. Evolutionary foundations

Page: 33   

What is meant by endosymbiotic association?  How can this concept explain the evolution of eukaryotic cells that are capable of carrying out photosynthesis and/or aerobic metabolism?

 

 

Chapter 2   Water

 

 

 

Multiple Choice Questions

 

  1. Weak interactions in aqueous systems

Page: 43–45         

Which of these statements about hydrogen bonds is not true?

 

  1. Hydrogen bonds account for the anomalously high boiling point of water.
  2. In liquid water, the average water molecule forms hydrogen bonds with three to four other water molecules.
  3. Individual hydrogen bonds are much weaker than covalent bonds.
  4. Individual hydrogen bonds in liquid water exist for many seconds and sometimes for minutes.
  5. The strength of a hydrogen bond depends on the linearity of the three atoms involved in the bond.

 

  1. Weak interactions in aqueous systems

Page: 48   

A true statement about hydrophobic interactions is that they:

 

  1. are the driving force in the formation of micelles of amphipathic compounds in water.
  2. do not contribute to the structure of water-soluble proteins.
  3. have bonding energies of approximately 20–40 Kjoule per mole.
  4. involve the ability of water to denature proteins.
  5. primarily involve the effect of polar solutes on the entropy of aqueous systems.

 

  1. Weak interactions in aqueous systems

Page: 48–49         

Hydrophobic interactions make important energetic contributions to:

 

  1. binding of a hormone to its receptor protein.
  2. enzyme-substrate interactions.
  3. membrane structure.
  4. three-dimensional folding of a polypeptide chain.
  5. all of the above are true.

 

  1. Weak interactions in aqueous systems

Page: 51   

Dissolved solutes alter some physical (colligative) properties of the solvent water because they change the:

 

  1. concentration of the water.
  2. hydrogen bonding of the water.
  3. ionic bonding of the water.
  4. pH of the water.
  5. temperature of the water.

 

 

  1. Weak interactions in aqueous systems

Page: 51   

Osmosis is movement of a:

 

  1. charged solute molecule (ion) across a membrane.
  2. gas molecule across a membrane.
  3. nonpolar solute molecule across a membrane.
  4. polar solute molecule across a membrane.
  5. water molecule across a membrane.

 

  1. Ionization of water, weak acids, and weak bases

Page: 54   

A hydronium ion:

 

  1. has the structure H3O+.
  2. is a hydrated hydrogen ion.
  3. is a hydrated proton.
  4. is the usual form of one of the dissociation products of water in solution.
  5. all of the above are true.

 

  1. Ionization of water, weak acids, and weak bases

Page: 56   

The pH of a solution of 1 M HCl is:

 

  1. 0
  2. 1
  3. 1
  4. 10
  5. –1

 

  1. Ionization of water, weak acids, and weak bases

Page: 56   

The pH of a solution of 0.1 M NaOH is:

 

  1. 1
  2. 0
  3. 8
  4. 13
  5. 14

 

  1. Ionization of water, weak acids, and weak bases

Page: 56   

Which of the following is true about the properties of aqueous solutions?

 

  1. A pH change from 5.0 to 6.0 reflects an increase in the hydroxide ion concentration ([OH]) of 20%.
  2. A pH change from 8.0 to 6.0 reflects a decrease in the proton concentration ([H+]) by a factor of 100.
  3. Charged molecules are generally insoluble in water.
  4. Hydrogen bonds form readily in aqueous solutions.
  5. The pH can be calculated by adding 7 to the value of the pOH.
  6. Ionization of water, weak acids, and weak bases

Page: 56   

The pH of a sample of blood is 7.4, while gastric juice is pH 1.4.  The blood sample has:

 

  1. 189 times the [H+] as the gastric juice.
  2. 29 times lower [H+] than the gastric juice.
  3. 6 times lower [H+] than the gastric juice.
  4. 6,000 times lower [H+] than the gastric juice.
  5. a million times lower [H+] than the gastric juice.

 

  1. Ionization of water, weak acids, and weak bases

Page: 57   

The aqueous solution with the lowest pH is:

 

  1. 01 M HCl.
  2. 1 M acetic acid (pKa = 4.86).
  3. 1 M formic acid (pKa = 3.75).
  4. 1 M HCl.
  5. 10–12 M NaOH.

 

  1. Ionization of water, weak acids, and weak bases

Page: 57   

The aqueous solution with the highest pH is:

 

  1. 1 M HCl.
  2. 1 M NH3 (pKa = 9.25).
  3. 5 M NaHCO3 (pKa = 3.77).
  4. 1 M NaOH.
  5. 001 M NaOH.

 

  1. Ionization of water, weak acids, and weak bases

Page: 57   

Phosphoric acid is tribasic, with pKa’s of 2.14, 6.86, and 12.4. The ionic form that predominates at pH 3.2 is:

 

  1. H3PO4.
  2. H2PO4.
  3. HPO42–.
  4. PO43–.
  5. none of the above.

 

  1. Buffering against pH changes in biological systems

Page: 59-60

Which of the following statements about buffers is true?

 

  1. A buffer composed of a weak acid of pKa = 5 is stronger at pH 4 than at pH 6.
  2. At pH values lower than the pKa, the salt concentration is higher than that of the acid.
  3. The pH of a buffered solution remains constant no matter how much acid or base is added to the solution.
  4. The strongest buffers are those composed of strong acids and strong bases.
  5. When pH = pKa, the weak acid and salt concentrations in a buffer are equal.

 

  1. Buffering against pH changes in biological systems

Page: 59-61                      

A compound has a pKa of 7.4.  To 100 mL of a 1.0 M solution of this compound at pH 8.0 is added 30 mL of 1.0 M hydrochloric acid. The resulting solution is pH:

 

  1. 5
  2. 8
  3. 2
  4. 4
  5. 5

 

  1. Buffering against pH changes in biological systems

Page: 60-61          

The Henderson-Hasselbalch equation:

 

  1. allows the graphic determination of the molecular weight of a weak acid from its pH alone.
  2. does not explain the behavior of di- or tri-basic weak acids
  3. employs the same value for pKa for all weak acids.
  4. is equally useful with solutions of acetic acid and of hydrochloric acid.
  5. relates the pH of a solution to the pKa and the concentrations of acid and conjugate base.

 

  1. Buffering against pH changes in biological systems

Page: 60–61         

Consider an acetate buffer, initially at the same pH as its pKa (4.76).  When sodium hydroxide (NaOH) is mixed with this buffer, the:

 

  1. pH remains constant.
  2. pH rises more than if an equal amount of NaOH is added to an acetate buffer initially at pH 6.76.
  3. pH rises more than if an equal amount of NaOH is added to unbuffered water at pH 4.76.
  4. ratio of acetic acid to sodium acetate in the buffer falls.
  5. sodium acetate formed precipitates because it is less soluble than acetic acid.

 

  1. Buffering against pH changes in biological systems

Page: 60–61                     

A compound is known to have a free amino group with a pKa of 8.8, and one other ionizable group with a pKa between 5 and 7.  To 100 mL of a 0.2 M solution of this compound at pH 8.2 was added 40 mL of a solution of 0.2 M hydrochloric acid.  The pH changed to 6.2.  The pKa of the second ionizable group is:

 

  1. The pH cannot be determined from this information.
  2. 4
  3. 6
  4. 0
  5. 2

 

 

  1. Buffering against pH changes in biological systems

Page: 60–61         

Three buffers are made by combining a 1 M solution of acetic acid with a 1 M solution of sodium acetate in the ratios shown below.

 

            1 M acetic acid            1 M sodium acetate

Buffer 1:     10 mL                        90 mL

Buffer 2:     50 mL                        50 mL

Buffer 3:     90 mL                        10 mL

 

Which of these statements is true of the resulting buffers?

 

  1. pH of buffer 1 < pH of buffer 2 < pH of buffer 3
  2. pH of buffer 1 = pH of buffer 2 = pH of buffer 3
  3. pH of buffer 1 > pH of buffer 2 > pH of buffer 3
  4. The problem cannot be solved without knowing the value of pKa.
  5. None of the above.

 

  1. Buffering against pH changes in biological systems

Page: 61–63                     

A 1.0 M solution of a compound with 2 ionizable groups (pKa’s = 6.2 and 9.5; 100 mL total) has a pH of 6.8.  If a biochemist adds 60 mL of 1.0 M HCl to this solution, the solution will change to pH:

 

  1. 60
  2. 90
  3. 13
  4. 32
  5. The pH cannot be determined from this information.

 

  1. Water as a reactant

Page: 65               

In which reaction below does water not participate as a reactant (rather than as a product)?

 

  1. Conversion of an acid anhydride to two acids.
  2. Conversion of an ester to an acid and an alcohol.
  3. Conversion of ATP to ADP.
  4. Photosynthesis
  5. Production of gaseous carbon dioxide from bicarbonate.

 

  1. The fitness of the aqueous environment for living organisms

Pages: 65–66       

Which of the following properties of water does not contribute to the fitness of the aqueous environment for living organisms?

 

  1. Cohesion of liquid water due to hydrogen bonding.
  2. High heat of vaporization.
  3. High specific heat.
  4. The density of water is greater than the density of ice.
  5. The very low molecular weight of water.

 

 

Short Answer Questions

 

  1. Weak interactions in aqueous systems

Page: 43–51         

Name and briefly define four types of noncovalent interactions that occur between biological molecules.

 

 

  1. Weak interactions in aqueous systems

Page: 46–48         

Explain the fact that ethanol (CH3CH2OH) is more soluble in water than is ethane (CH3CH3).

 

 

  1. Weak interactions in aqueous systems

Page: 46–48         

Explain the fact that triethylammonium chloride ((CH3CH2)3N•HCl) is more soluble in water than is triethylamine ((CH3CH2)3N).

 

 

  1. Weak interactions in aqueous systems

Page: 48   

Explain with an appropriate diagram why amphipathic molecules tend to form micelles in water.  What force drives micelle formation?

 

 

 

  1. Weak interactions in aqueous systems

Pages: 51–52       

  • Briefly define “isotonic,” “hypotonic,” and “hypertonic” solutions. (b) Describe what happens when a cell is placed in each of these types of solutions.

 

 

  1. Ionization of water, weak acids, and weak bases

Page: 57    Difficulty: 1

For each of the pairs below, circle the conjugate base.

 

RCOOH      RCOO

 

RNH2          RNH3+

 

H2PO4        H3PO4

 

H2CO3         HCO3

 

 

  1. Ionization of water, weak acids, and weak bases

Page: 57   

Phosphoric acid (H3PO4) has three dissociable protons, with the pKa’s shown below.  Which form of phosphoric acid predominates in a solution at pH 4?  Explain your answer.

Acid           pKa

H3PO4        2.14

 

H2PO4      6.86

 

HPO42–      12.4

 

 

  1. Ionization of water, weak acids, and weak bases

Page: 58–59          Difficulty: 1

Define pKa for a weak acid in the following two ways:  (1) in relation to its acid dissociation constant, Ka, and (2) by reference to a titration curve for the weak acid.

 

 

  1. Buffering against pH changes in biological systems

Page: 58–60         

 

  1. Buffering against pH changes in biological systems

Pages: 59–60       

Draw the titration curve for a weak acid, HA, whose pKa is 3.2. Label the axes properly. Indicate with an arrow where on the curve the ratio of salt (A) to acid (HA) is 3:1.  What is the pH at this point?

 

pH = pKa + log = 3.2 + log 3 = 3.2 + 0.48 = 3.68

 

 

  1. Buffering against pH changes in biological systems

Page: 61–62         

What is the pH of a solution containing 0.2 M acetic acid (pKa = 4.7) and 0.1 M sodium acetate?

 

 

  1. Buffering against pH changes in biological systems

Page: 61–62         

You have just made a solution by combining 50 mL of a 0.1 M sodium acetate solution with 150 mL of 1 M acetic acid (pKa = 4.7). What is the pH of the resulting solution?

 

 

  1. Buffering against pH changes in biological systems

Page: 61–62         

For a weak acid with a pKa of 6.0, show how you would calculate the ratio of acid to salt at pH 5.

 

 

 

  1. Buffering against pH changes in biological systems

Page: 61-62          

Suppose you have just added 100 mL of a solution containing 0.5 mol of acetic acid per liter to 400 mL of 0.5 M NaOH.  What is the final pH?  (The pKa of acetic acid is 4.7.)

 

ddition of 200 mmol of NaOH (400 mL ´ 0.5 M) to 50 mmol of acetic acid (100 mL ´ 0.5 mM)

 

  1. Buffering against pH changes in biological systems

Page: 61-62          

A weak acid HA, has a pKa of 5.0.  If 1.0 mol of this acid and 0.1 mol of NaOH were dissolved in one liter of water, what would the final pH be?

 

  1. Water as a reactant

Page: 65    Difficulty: 1

Give an example of a biological reaction in which water participates as a reactant and a reaction in which it participates as a product.

 

 

  1. The fitness of the aqueous environment for living organisms

Pages: 65–66        Difficulty: 1

If ice were denser than water, how would that affect life on earth?

 

 

 

Chapter 3  Amino Acids, Peptides, and Proteins

 

 

 

Multiple Choice Questions

 

  1. Amino acids

Page: 72   

The chirality of an amino acid results from the fact that its a carbon:

 

  1. has no net charge.
  2. is a carboxylic acid.
  3. is bonded to four different chemical groups.
  4. is in the l absolute configuration in naturally occurring proteins.
  5. is symmetric.

 

  1. Amino acids

Page: 72   

Of the 20 standard amino acids, only ___________ is not optically active.  The reason is that its side chain ___________.

 

  1. alanine; is a simple methyl group
  2. glycine; is a hydrogen atom
  3. glycine; is unbranched
  4. lysine; contains only nitrogen
  5. proline; forms a covalent bond with the amino group

 

  1. Amino acids

Page: 72   

Two amino acids of the standard 20 contain sulfur atoms.  They are:

 

  1. cysteine and serine.
  2. cysteine and threonine.
  3. methionine and cysteine
  4. methionine and serine
  5. threonine and serine.

 

  1. Amino acids

Page: 75

All of the amino acids that are found in proteins, except for proline, contain a(n):

 

  1. amino group.
  2. carbonyl group.
  3. carboxyl group.
  4. ester group.
  5. thiol group.

 

 

 

 

  1. Amino acids

Pages: 75–76                   

Which of the following statements about aromatic amino acids is correct?

 

  1. All are strongly hydrophilic.
  2. Histidine’s ring structure results in its being categorized as aromatic or basic, depending on pH.
  3. On a molar basis, tryptophan absorbs more ultraviolet light than tyrosine.
  4. The major contribution to the characteristic absorption of light at 280 nm by proteins is the phenylalanine R group.
  5. The presence of a ring structure in its R group determines whether or not an amino acid is aromatic.

 

  1. Amino acids

Page: 77   

Which of the following statements about cystine is correct?

 

  1. Cystine forms when the —CH2—SH R group is oxidized to form a —CH2—S—S—CH2— disulfide bridge between two cysteines.
  2. Cystine is an example of a nonstandard amino acid, derived by linking two standard amino acids.
  3. Cystine is formed by the oxidation of the carboxylic acid group on cysteine.
  4. Cystine is formed through a peptide linkage between two cysteines.
  5. Two cystines are released when a —CH2—S—S—CH2— disulfide bridge is reduced to —CH2—SH.

 

  1. Amino acids

Page: 77   

The uncommon amino acid selenocysteine has an R group with the structure —CH2—SeH (pKa » 5).  In an aqueous solution, pH = 7.0, selenocysteine would:

 

  1. be a fully ionized zwitterion with no net charge.
  2. be found in proteins as d-selenocysteine.
  3. never be found in a protein.
  4. be nonionic.
  5. not be optically active.

 

  1. Amino acids

Pages: 78–79       

Amino acids are ampholytes because they can function as either a(n):

 

  1. acid or a base.
  2. neutral molecule or an ion.
  3. polar or a nonpolar molecule.
  4. standard or a nonstandard monomer in proteins.
  5. transparent or a light-absorbing compound.

 

 

 

 

 

 

 

  1. Amino acids

Pages: 79–80       

Titration of valine by a strong base, for example NaOH, reveals two pK’s.  The titration reaction occurring at pK2 (pK2 = 9.62) is:

 

  1. A) —COOH + OH ®          —COO + H2
  2. B) —COOH + —NH2               ®    —COO + —NH2+.
  3. C) —COO + —NH2+               ®    —COOH + —NH2.
  4. D) —NH3+ + OH ®          —NH2 + H2
  5. E) —NH2 + OH ®          —NH + H2

 

  1. Amino acids

Pages: 79–80       

In a highly basic solution, pH = 13, the dominant form of glycine is:

 

  1. NH2—CH2—COOH.
  2. NH2—CH2—COO.
  3. NH2—CH3+—COO.
  4. NH3+—CH2—COOH.
  5. NH3+—CH2—COO.

 

  1. Amino acids

Pages: 80–81       

For amino acids with neutral R groups, at any pH below the pI of the amino acid, the population of amino acids in solution will have:

 

  1. a net negative charge.
  2. a net positive charge.
  3. no charged groups.
  4. no net charge.
  5. positive and negative charges in equal concentration.

 

  1. Amino acids

Pages: 80–81       

At pH 7.0, converting a glutamic acid to g-carboxyglutamate, will have what effect on the overall charge of the protein containing it?

 

  1. it will become more negative
  2. it will become more positive.
  3. it will stay the same.
  4. there is not enough information to answer the question.
  5. the answer depends on the salt concentration.

 

 

  1. Amino acids

Pages: 80–81       

At pH 7.0, converting a proline to hydroxyproline, will have what effect on the overall charge of the protein containing it?

 

  1. it will become more negative
  2. it will become more positive.
  3. it will stay the same.
  4. there is not enough information to answer the question.
  5. the answer depends on the salt concentration.

 

  1. Amino acids

Pages: 80–81                   

        What is the approximate charge difference between glutamic acid and a-ketoglutarate at pH 9.5?

 

  1. 0
  2. ½
  3. 1
  4. 2

 

  1. Peptides and proteins

Page: 82   

The formation of a peptide bond between two amino acids is an example of a(n) ______________ reaction.

 

  1. cleavage
  2. condensation
  3. group transfer
  4. isomerization
  5. oxidation reduction

 

  1. Peptides and proteins

Page: 82   

The peptide alanylglutamylglycylalanylleucine has:

 

  1. a disulfide bridge.
  2. five peptide bonds.
  3. four peptide bonds.
  4. no free carboxyl group.
  5. two free amino groups.

 

  1. Peptides and proteins

Pages: 82–83       

An octapeptide composed of four repeating glycylalanyl units has:

 

  1. one free amino group on an alanyl residue.
  2. one free amino group on an alanyl residue and one free carboxyl group on a glycyl residue.
  3. one free amino group on a glycyl residue and one free carboxyl group on an alanyl residue.
  4. two free amino and two free carboxyl groups.
  5. two free carboxyl groups, both on glycyl residues.

 

  1. Peptides and proteins

Page: 82–83         

At the isoelectric pH of a tetrapeptide:

 

  1. only the amino and carboxyl termini contribute charge.
  2. the amino and carboxyl termini are not charged.
  3. the total net charge is zero.
  4. there are four ionic charges.
  5. two internal amino acids of the tetrapeptide cannot have ionizable R groups.

 

  1. Peptides and proteins

Pages: 83–84       

Which of the following is correct with respect to the amino acid composition of proteins?

 

  1. Larger proteins have a more uniform distribution of amino acids than smaller proteins.
  2. Proteins contain at least one each of the 20 different standard amino acids.
  3. Proteins with different functions usually differ significantly in their amino acid composition.
  4. Proteins with the same molecular weight have the same amino acid composition.
  5. The average molecular weight of an amino acid in a protein increases with the size of the protein.

 

  1. Peptides and proteins

Page: 83   

The average molecular weight of the 20 standard amino acids is 138, but biochemists use 110 when estimating the number of amino acids in a protein of known molecular weight.  Why?

 

  1. The number 110 is based on the fact that the average molecular weight of a protein is 110,000 with an average of 1,000 amino acids.
  2. The number 110 reflects the higher proportion of small amino acids in proteins, as well as the loss of water when the peptide bond forms.
  3. The number 110 reflects the number of amino acids found in the typical small protein, and only small proteins have their molecular weight estimated this way.
  4. The number 110 takes into account the relatively small size of nonstandard amino acids.
  5. The number 138 represents the molecular weight of conjugated amino acids.

 

  1. Peptides and proteins

Page: 84   

In a conjugated protein, a prosthetic group is:

 

  1. a fibrous region of a globular protein.
  2. a nonidentical subunit of a protein with many identical subunits.
  3. a part of the protein that is not composed of amino acids.
  4. a subunit of an oligomeric protein.
  5. synonymous with “protomer.”

 

 

  1. Peptides and proteins

Pages: 84–85       

Prosthetic groups in the class of proteins known as glycoproteins are composed of:

 

  1. flavin nucleotides.
  2. metals .

 

  1. Working with proteins

Page: 85   

For the study of a protein in detail, an effort is usually made to first:

 

  1. conjugate the protein to a known molecule.
  2. determine its amino acid composition.
  3. determine its amino acid sequence.
  4. determine its molecular weight.
  5. purify the protein.

 

  1. Working with proteins

Page: 87   

In a mixture of the five proteins listed below, which should elute second in size-exclusion (gel- filtration) chromatography?

 

  1. cytochrome c  Mr =   13,000
  2. immunoglobulin G Mr = 145,000
  3. ribonuclease A  Mr =   13,700
  4. RNA polymerase Mr = 450,000
  5. serum albumin Mr =   68,500

 

  1. Working with proteins

Page: 89   

By adding SDS (sodium dodecyl sulfate) during the electrophoresis of proteins, it is possible to:

 

  1. determine a protein’s isoelectric point.
  2. determine an enzyme’s specific activity.
  3. determine the amino acid composition of the protein.
  4. preserve a protein’s native structure and biological activity.
  5. separate proteins exclusively on the basis of molecular weight.

 

  1. Working with proteins

Page: 90   

To determine the isoelectric point of a protein, first establish that a gel:

 

  1. contains a denaturing detergent that can distribute uniform negative charges over the protein’s surface.
  2. exhibits a stable pH gradient when ampholytes become distributed in an electric field.
  3. is washed with an antibody specific to the protein of interest.
  4. neutralizes all ionic groups on a protein by titrating them with strong bases.
  5. relates the unknown protein to a series of protein markers with known molecular weights, Mr.

 

  1. Working with proteins

Pages: 90–91                   

The first step in two-dimensional gel electrophoresis generates a series of protein bands by isoelectric focusing.  In a second step, a strip of this gel is turned 90 degrees, placed on another gel containing SDS, and electric current is again applied.  In this second step:

 

  1. proteins with similar isoelectric points become further separated according to their molecular weights.
  2. the individual bands become stained so that the isoelectric focus pattern can be visualized.
  3. the individual bands become visualized by interacting with protein-specific antibodies in the second gel.
  4. the individual bands undergo a second, more intense isoelectric focusing.
  5. the proteins in the bands separate more completely because the second electric current is in the opposite polarity to the first current.

 

  1. Working with proteins

Page: 91   

The term specific activity differs from the term activity in that specific activity:

 

  1. is measured only under optimal conditions.
  2. is the activity (enzyme units) in a milligram of protein.
  3. is the activity (enzyme units) of a specific protein.
  4. refers only to a purified protein.
  5. refers to proteins other than enzymes.

 

  1. Peptides and proteins

Page: 92   

Which of the following refers to particularly stable arrangements of amino acid residues in a protein that give rise to recurring patterns?

 

  1. Primary structure
  2. Secondary structure
  3. Tertiary structure
  4. Quaternary structure
  5. None of the above

 

  1. Peptides and proteins

Page: 92

Which of the following describes the overall three-dimensional folding of a polypeptide?

 

  1. Primary structure
  2. Secondary structure
  3. Tertiary structure
  4. Quaternary structure
  5. None of the above

 

 

  1. The covalent structure of proteins

Page: 93   

The functional differences, as well as differences in three-dimensional structures, between two different enzymes from E. coli result directly from their different:

 

  1. affinities for ATP.
  2. amino acid sequences.
  3. roles in DNA metabolism.
  4. roles in the metabolism of coli.
  5. secondary structures.

 

  1. The covalent structure of proteins

Page: 95   

One method used to prevent disulfide bond interference with protein sequencing procedures is:

 

  1. cleaving proteins with proteases that specifically recognize disulfide bonds.
  2. protecting the disulfide bridge against spontaneous reduction to cysteinyl sulfhydryl groups.
  3. reducing disulfide bridges and preventing their re-formation by further modifying the —SH groups.
  4. removing cystines from protein sequences by proteolytic cleavage.
  5. sequencing proteins that do not contain cysteinyl residues.

 

  1. The covalent structure of proteins

Pages: 96–97                   

A nonapeptide was determined to have the following amino acid composition: (Lys)2, (Gly) 2, (Phe) 2, His, Leu, Met.  The native peptide was incubated with 1-fluoro-2,4-dinitrobenzene (FDNB) and then hydrolyzed; 2,4-dinitrophenylhistidine was identified by HPLC. When the native peptide was exposed to cyanogen bromide (CNBr), an octapeptide and free glycine were recovered.  Incubation of the native peptide with trypsin gave a pentapeptide, a tripeptide, and free Lys.  2,4-Dinitrophenyl-histidine was recovered from the pentapeptide, and 2,4-dinitrophenylphenylalanine was recovered from the tripeptide.  Digestion with the enzyme pepsin produced a dipeptide, a tripeptide, and a tetrapeptide.  The tetrapeptide was composed of (Lys) 2, Phe, and Gly.  The native sequence was determined to be:

 

  1. Gly–Phe–Lys–Lys–Gly–Leu–Met–Phe–His.
  2. His–Leu–Gly–Lys–Lys–Phe–Phe–Gly–Met.
  3. His–Leu–Phe–Gly–Lys–Lys–Phe–Met–Gly.
  4. His–Phe–Leu–Gly–Lys–Lys–Phe–Met–Gly.
  5. Met–Leu–Phe–Lys–Phe–Gly–Gly–Lys–His.

 

  1. The covalent structure of proteins

Pages: 96–97       

Even when a gene is available and its sequence of nucleotides is known, chemical studies of the protein are still required to determine:

 

  1. molecular weight of the protein.
  2. the amino-terminal amino acid.
  3. the location of disulfide bonds.
  4. the number of amino acids in the protein.
  5. whether the protein has the amino acid methionine in its sequence.

 

  1. The covalent structure of proteins

Page: 100 

The term “proteome” has been used to describe:

 

  1. regions (domains) within proteins.
  2. regularities in protein structures.
  3. the complement of proteins encoded by an organism’s DNA.
  4. the structure of a protein-synthesizing ribosome.
  5. the tertiary structure of a protein.

 

  1. The covalent structure of proteins

Pages: 98–100     

A major advance in the application of mass spectrometry to macromolecules came with the development of techniques to overcome which of the following problems?

 

  1. Macromolecules were insoluble in the solvents used in mass spectrometry.
  2. Mass spectrometric analyses of macromolecules were too complex to interpret.
  3. Mass spectrometric analysis involved molecules in the gas phase.
  4. Most macromolecules could not be purified to the degree required for mass spectrometric analysis.
  5. The specialized instruments required were prohibitively expensive.

 

  1. Protein sequences and evolution

Pages: 102–106               

Compare the following sequences taken from four different proteins, and select the answer that best characterizes their relationships.

A                                             B                                               C

1  DVEKGKKIDIMKCS    HTVEKGGKHKTGPNLH          GLFGRKTGQAPGYSYT

2  DVQRALKIDNNLGQ  HTVEKGAKHKTAPNVH         GLADRIAYQAKATNEE

3  LVTRPLYIFPNEGQ      HTLEKAAKHKTGPNLH          ALKSSKDLMFTVINDD

4  FFMNEDALVARSSN   HQFAASSIHKNAPQFH            NLKDSKTYLKPVISET

 

 

  1. Based only on sequences in column B, protein 4 reveals the greatest evolutionary divergence.
  2. Comparing proteins 1 and 2 in column A reveals that these two proteins have diverged the most throughout evolution.
  3. Protein 4 is the protein that shows the greatest overall homology to protein 1.
  4. Proteins 2 and 3 show a greater evolutionary distance than proteins 1 and 4.
  5. The portions of amino acid sequence shown suggest that these proteins are completely unrelated.

 

 

Short Answer Questions

 

  1. Amino acids

Page: 72    Difficulty: 1

What are the structural characteristics common to all amino acids found in naturally occurring proteins?

 

 

  1. Amino acids

Page: 75    Difficulty: 1

Only one of the common amino acids has no free a-amino group.  Name this amino acid and draw its structure.

 

 

  1. Amino acids

Pages: 74–77       

Briefly describe the five major groupings of amino acids.

 

 

  1. Amino acids

Pages: 73–75       

 

A                       B                         C                         D                         E

__________________________________________________________________

Tyr-Lys-Met  Gly-Pro-Arg        Asp-Trp-Tyr       Asp-His-Glu       Leu-Val-Phe

 

Which one of the above tripeptides:

____(a)  is most negatively charged at pH 7?

____(b)  will yield DNP-tyrosine when reacted with l-fluoro-2,4-dinitrobenzene and hydrolyzed in acid?

____(c)  contains the largest number of nonpolar R groups?

____(d)  contains sulfur?

____(e)  will have the greatest light absorbance at 280 nm?

 

 

  1. Amino acids

Pages: 73–75       

Draw the structures of the amino acids phenylalanine and aspartate in the ionization state you would expect at pH 7.0. Why is aspartate very soluble in water, whereas phenylalanine is much less soluble?

 

  1. Amino acids

Pages: 77–78       

Name two uncommon amino acids that occur in proteins.  By what route do they get into proteins?

 

 

  1. Amino acids

Pages: 78–79        Difficulty: 1

Why do amino acids, when dissolved in water, become zwitterions?

 

 

  1. Amino acids

Page: 79    Difficulty: 1

As more OH equivalents (base) are added to an amino acid solution, what titration reaction will occur around pH = 9.5?

 

 

  1. Amino acids

Page: 80   

In the amino acid glycine, what effect does the positively charged —NH3+ group have on the pKa of an amino acid’s —COOH group?

 

 

  1. Amino acids

Page: 79

How does the shape of a titration curve confirm the fact that the pH region of greatest buffering power for an amino acid solution is around its pK’s?

 

 

  1. Amino acids

Page: 79   

Leucine has two dissociable protons: one with a pKa of 2.3, the other with a pKa of 9.7.  Sketch a properly labeled titration curve for leucine titrated with NaOH; indicate where the pH = pK and the region(s) in which buffering occurs.

 

 

  1. Amino acids

Page: 80   

What is the pI, and how is it determined for amino acids that have nonionizable R groups?

 

 

  1. Amino acids

Page: 80   

The amino acid histidine has a side chain for which the pKa is 6.0.  Calculate what fraction of the histidine side chains will carry a positive charge at pH 5.4.  Be sure to show your work.

 

 

  1. Amino acids

Page: 80   

The amino acid histidine has three ionizable groups, with pKa values of 1.8, 6.0, and 9.2.  (a) Which pKa corresponds to the histidine side chain?  (b) In a solution at pH 5.4, what percentage of the histidine side chains will carry a positive charge?

 

  1. Amino acids

Page: 81   

What is the uniquely important acid-base characteristic of the histidine R group?

 

 

  1. Peptides and proteins

Page: 82    Difficulty: 1

How can a polypeptide have only one free amino group and one free carboxyl group?

 

 

  1. Peptides and proteins

Page: 82    Difficulty: 1

Hydrolysis of peptide bonds is an exergonic reaction.  Why, then, are peptide bonds quite stable?

 

 

  1. Peptides and proteins

Page: 82   

Draw the structure of Gly–Ala–Glu in the ionic form that predominates at pH 7.

 

 

  1. Peptides and proteins

Page: 82

The artificial sweetener NutraSweet®, also called aspartame, is a simple dipeptide, aspartylphenylalanine methyl ester, on which the free carboxyl of the dipeptide is esterified to methyl alcohol. Draw the structure of aspartame, showing the ionizable groups in the form they have at pH 7.  (The ionizable group in the side chain of aspartate has a pKa of 3.96.)

 

 

  1. Peptides and proteins

Page: 84    Difficulty: 1

If the average molecular weight of the 20 standard amino acids is 138, why do biochemists divide a protein’s molecular weight by 110 to estimate its number of amino acid residues?

 

  1. Peptides and proteins

Page: 84   

Lys residues make up 10.5% of the weight of ribonuclease.  The ribonuclease molecule contains 10 Lys residues.  Calculate the molecular weight of ribonuclease.

 

 

  1. Working with proteins

Pages: 86-87        

Why do smaller molecules elute after large molecules when a mixture of proteins is passed through a size-exclusion (gel filtration) column?

 

 

  1. Working with proteins

Pages: 86-87        

For each of these methods of separating proteins, describe the principle of the method, and tell what property of proteins allows their separation by this technique.

(a)  ion-exchange chromatography

(b)  size-exclusion (gel filtration) chromatography

  • affinity chromatography

 

  1. Working with proteins

Pages: 86-88        

A biochemist is attempting to separate a DNA-binding protein (protein X) from other proteins in a solution.  Only three other proteins (A, B, and C) are present.  The proteins have the following properties:

pI

(isoelectric           Size               Bind to

point)                Mr                 DNA?

––––––––––––––––––––––––––––––––––––––––––

protein A        7.4               82,000                yes

protein B         3.8               21,500                yes

protein C         7.9               23,000                  no

protein X        7.8               22,000                yes

––––––––––––––––––––––––––––––––––––––––––

 

What type of protein separation techniques might she use to separate

(a) protein X from protein A?

(b) protein X from protein B?

(c) protein X from protein C?

 

 

  1. Working with proteins

Pages: 88-89        

What factors would make it difficult to interpret the results of a gel electrophoresis of proteins in the absence of sodium dodecyl sulfate (SDS)?

 

 

  1. Working with proteins

Pages: 90-91        

How can isoelectric focusing be used in conjunction with SDS gel electrophoresis?

 

  1. Working with proteins

Pages: 91-92        

You are given a solution containing an enzyme that converts B into A.  Describe what you would do to determine the specific activity of this enzyme solution.

 

 

  1. Working with proteins

Pages: 91-92        

As a protein is purified, both the amount of total protein and the activity of the purified protein decrease.  Why, then, does the specific activity of the purified protein increase?

 

 

  1. Peptides and proteins

Page: 84    Difficulty: 1

Define the primary structure of a protein.

 

  1. The covalent structure of proteins

Pages: 94-100      

In one or two sentences, describe the usefulness of each of the following reagents or reactions in the analysis of protein structure:

(a)  Edman reagent (phenylisothiocyanate)

(b)  Sanger reagent (1-fluoro-2,4-dinitrobenzene, FDNB)

  • trypsin

 

  1. The covalent structure of proteins

Pages: 96-97        

A polypeptide is hydrolyzed, and it is determined that there are 3 Lys residues and 2 Arg residues (as well as other residues). How many peptide fragments can be expected when the native polypeptide is incubated with the proteolytic enzyme trypsin?

 

  1. The covalent structure of proteins

Pages: 94-95        

The following reagents are often used in protein chemistry. Match the reagent with the purpose for which it is best suited. Some answers may be used more than once or not at all; more than one reagent may be suitable for a given purpose.

 

(a) CNBr (cyanogen bromide)                      (e) performic acid

(b) Edman reagent (phenylisothiocyanate)    (f) chymotrypsin

(c) FDNB                                                      (g) trypsin

(d) dithiothreitol

 

___ hydrolysis of peptide bonds on the carboxyl side of Lys and Arg

___ cleavage of peptide bonds on the carboxyl side of Met

___ breakage of disulfide (—S—S—) bonds

___ determination of the amino acid sequence of a peptide

___ determining the amino-terminal amino acid in a polypeptide

 

 

  1. The covalent structure of proteins

Pages: 94-97        

A biochemist wishes to determine the sequence of a protein that contains 123 amino acid residues.  After breaking all of the disulfide bonds, the protein is treated with cyanogen bromide (CNBr), and it is determined that that this treatment breaks up the protein into seven conveniently sized peptides, which are separated from each other.  It is your turn to take over.  Outline the steps you would take to determine, unambiguously, the sequence of amino acid residues in the original protein.

 

 

  1. The covalent structure of proteins

Pages: 94-97        

You are trying to determine the sequence of a protein that you know is pure.  Give the most likely explanation for each of the following experimental observations.  You may use a simple diagram for your answer.

(a)  The Sanger reagent (FDNB, fluorodinitrobenzene) identifies Ala and Leu as amino-terminal residues, in roughly equal amounts.

(b)  Your protein has an apparent Mr of 80,000, as determined by SDS-polyacrylamide gel electrophoresis.  After treatment of the protein with performic acid, the same technique reveals two proteins of Mr 35,000 and 45,000.

(c)  Size-exclusion chromatography (gel filtration) experiments indicate the native protein has an apparent Mr of 160,000.

 

  1. The covalent structure of proteins

Page: 101 

Describe two major differences between chemical synthesis of polypeptides and synthesis of polypeptides in the living cell.

 

 

  1. Protein sequences and evolution

Page: 102-104      

Distinguish between homologs, paralogs, and orthologs as classes of related proteins.

 

 

  1. Protein sequences and evolution

Page: 105 

How are “signature sequences” useful in analyzing groups of functionally related proteins?

 

 

more elaborate evolutionary trees based on protein sequences.

Chapter 4   The Three-Dimensional Structure of Proteins

 

 

 

Multiple Choice Questions

 

  1. Overview of protein structure

Pages: 114115   

All of the following are considered “weak” interactions in proteins, except:

 

  1. hydrogen bonds.
  2. hydrophobic interactions.
  3. ionic bonds.
  4. peptide bonds.
  5. van der Waals forces.

 

  1. Overview of protein structure

Pages: 114115   

The most important contribution to the stability of a protein’s conformation appears to be the:

 

  1. entropy increase from the decrease in ordered water molecules forming a solvent shell around it.
  2. maximum entropy increase from ionic interactions between the ionized amino acids in a protein.
  3. sum of free energies of formation of many weak interactions among the hundreds of amino acids in a protein.
  4. sum of free energies of formation of many weak interactions between its polar amino acids and surrounding water.
  5. stabilizing effect of hydrogen bonding between the carbonyl group of one peptide bond and the amino group of another.

 

  1. Overview of protein structure

Page: 115 

In an aqueous solution, protein conformation is determined by two major factors.  One is the formation of the maximum number of hydrogen bonds.  The other is the:

 

  1. formation of the maximum number of hydrophilic interactions.
  2. maximization of ionic interactions.
  3. minimization of entropy by the formation of a water solvent shell around the protein.
  4. placement of hydrophobic amino acid residues within the interior of the protein.
  5. placement of polar amino acid residues around the exterior of the protein.

 

  1. Overview of protein structure

Page: 115 

Pauling and Corey’s studies of the peptide bond showed that:

 

  1. at pH 7, many different peptide bond conformations are equally probable.
  2. peptide bonds are essentially planar, with no rotation about the C—N axis.
  3. peptide bonds in proteins are unusual, and unlike those in small model compounds.
  4. peptide bond structure is extraordinarily complex.
  5. primary structure of all proteins is similar, although the secondary and tertiary structure may differ greatly.

 

  1. Overview of protein structure

Page: 116             

In the diagram below, the plane drawn behind the peptide bond indicates the:

  1. absence of rotation around the C—N bond because of its partial double-bond character.
  2. plane of rotation around the Ca—N bond.
  3. region of steric hindrance determined by the large C=O group.
  4. region of the peptide bond that contributes to a Ramachandran plot.
  5. theoretical space between –180 and +180 degrees that can be occupied by the f and y angles in the peptide bond.

 

  1. Overview of protein structure

Page: 116 

Which of the following best represents the backbone arrangement of two peptide bonds?

 

  1. Ca—N—Ca—C—Ca—N—Ca—C
  2. Ca—N—C—C—N—Ca
  3. C—N—Ca—Ca—C—N
  4. Ca—C—N—Ca—C—N
  5. Ca—Ca—C—N—Ca—Ca—C

 

  1. Overview of protein structure

Page: 116 

Which of the following pairs of bonds within a peptide backbone show free rotation around both bonds?

 

  1. Ca—C and N—Ca
  2. C=O and N—C
  3. C=O and N—Ca
  4. N—C and Ca—C
  5. N—Ca and N—C

 

  1. Protein secondary structure

Page: 117 

Roughly how many amino acids are there in one turn of an a helix?

 

  1. 1
  2. 8
  3. 6
  4. 2
  5. 10

 

 

  1. Protein secondary structure

Pages: 117-119    

In the a helix the hydrogen bonds:

 

  1. are roughly parallel to the axis of the helix.
  2. are roughly perpendicular to the axis of the helix.
  3. occur mainly between electronegative atoms of the R groups.
  4. occur only between some of the amino acids of the helix.
  5. occur only near the amino and carboxyl termini of the helix.

 

  1. Protein secondary structure

Pages: 117-118    

In an a helix, the R groups on the amino acid residues:

 

  1. alternate between the outside and the inside of the helix.
  2. are found on the outside of the helix spiral.
  3. cause only right-handed helices to form.
  4. generate the hydrogen bonds that form the helix.
  5. stack within the interior of the helix.

 

  1. Protein secondary structure

Page: 119 

Thr and/or Leu residues tend to disrupt an a helix when they occur next to each other in a protein because:

 

  1. an amino acids like Thr is highly hydrophobic.
  2. covalent interactions may occur between the Thr side chains.
  3. electrostatic repulsion occurs between the Thr side chains.
  4. steric hindrance occurs between the bulky Thr side chains.
  5. the R group of Thr can form a hydrogen bond.

 

  1. Protein secondary structure

Page: 119

A d-amino acid would interrupt an a helix made of l-amino acids.  Another naturally occurring hindrance to the formation of an a helix is the presence of:

 

  1. a negatively charged Arg residue.
  2. a nonpolar residue near the carboxyl terminus.
  3. a positively charged Lys residue.
  4. a Pro residue.
  5. two Ala residues side by side.

 

  1. Protein secondary structure

Pages: 119-120                

An a helix would be destabilized most by:

 

  1. an electric dipole spanning several peptide bonds throughout the a
  2. interactions between neighboring Asp and Arg residues.
  3. interactions between two adjacent hydrophobic Val residues.
  4. the presence of an Arg residue near the carboxyl terminus of the a
  5. the presence of two Lys residues near the amino terminus of the a

  1. Protein secondary structure

Pages: 120-121    

The major reason that antiparallel b-stranded protein structures are more stable than parallel b-stranded structures is that the latter:

 

  1. are in a slightly less extended configuration than antiparallel strands.
  2. do not have as many disulfide crosslinks between adjacent strands.
  3. do not stack in sheets as well as antiparallel strands.
  4. have fewer lateral hydrogen bonds than antiparallel strands.
  5. have weaker hydrogen bonds laterally between adjacent strands.

 

  1. Protein secondary structure

Page: 121 

Amino acid residues commonly found in the middle of b turn are:

 

  1. Ala and Gly.
  2. Pro and Gly.
  3. those with ionized R-groups.
  4. two Cys.

 

  1. Protein secondary structure

Page: 121 

A sequence of amino acids in a certain protein is found to be -Ser-Gly-Pro-Gly-.  The sequence is most probably part of a(n):

 

  1. antiparallel b
  2. parallel b
  3. a
  4. a
  5. b

 

  1. Protein tertiary and quaternary structures

Page: 123 

The three-dimensional conformation of a protein may be strongly influenced by amino acid residues that are very far apart in sequence.  This relationship is in contrast to secondary structure, where the amino acid residues are:

 

  1. always side by side.
  2. generally near each other in sequence.
  3. invariably restricted to about 7 of the 20 standard amino acids.
  4. often on different polypeptide strands.
  5. usually near the polypeptide chain’s amino terminus or carboxyl terminus.

 

 

  1. Protein tertiary and quaternary structures

Page: 125             

The a-keratin chains indicated by the diagram below have undergone one chemical step. To alter the shape of the a-keratin chains—as in hair waving—what subsequent steps are required?

 

 

 

 

  1. Chemical oxidation and then shape remodeling
  2. Chemical reduction and then chemical oxidation
  3. Chemical reduction and then shape remodeling
  4. Shape remodeling and then chemical oxidation
  5. Shape remodeling and then chemical reduction

 

  1. Protein tertiary and quaternary structures

Pages: 124-125    

Which of the following statements is false?

 

  1. Collagen is a protein in which the polypeptides are mainly in the a-helix conformation.
  2. Disulfide linkages are important for keratin structure.
  3. Gly residues are particularly abundant in collagen.
  4. Silk fibroin is a protein in which the polypeptide is almost entirely in the b
  5. a-keratin is a protein in which the polypeptides are mainly in the a-helix conformation.

 

  1. Protein tertiary and quaternary structures

Pages: 129-130    

Kendrew’s studies of the globular myoglobin structure demonstrated that:

 

  1. “corners” between a-helical regions invariably lacked proline residue.
  2. highly polar or charged amino acid residues tended to be located interiorally.
  3. myoglobin was completely different from hemoglobin, as expected.
  4. the structure was very compact, with virtually no internal space available for water.
  5. the a helix predicted by Pauling and Corey was not found in myoglobin.

 

 

  1. Protein tertiary and quaternary structures

Pages: 132133   

Determining the precise arrangement of atoms within a large protein is possible only through the use of:

 

  1. electron microscopy.
  2. light microscopy.
  3. molecular model building.
  4. Ramachandran plots.
  5. x-ray diffraction.

 

  1. Protein tertiary and quaternary structures

Pages: 132134               

Analysis of x-ray diffraction data yields a(n)        ; analysis of 2D NMR data yields a(n)             .

 

  1. electron density map; count of hydrogen atoms in the molecule
  2. shadow of protein’s outline; estimate of protein’s molecular volume
  3. table of interatomic distances; electron density map
  4. electronic density map; table of interatomic distances
  5. 3-d protein structure; 2-d protein structure

 

  1. Protein tertiary and quaternary structures

Page: 135

Proteins often have regions that show specific, coherent patterns of folding or function.  These regions are called:

 

 

  1. Protein tertiary and quaternary structures

Page: 135 

Which of the following statements concerning protein domains is true?

 

  1. They are a form of secondary structure.
  2. They are examples of structural motifs.
  3. They consist of separate polypeptide chains (subunits).
  4. They have been found only in prokaryotic proteins.
  5. They may retain their correct shape even when separated from the rest of the protein.

 

  1. Protein tertiary and quaternary structures

Pages: 136-138

The structural classification of proteins (based on motifs) is based primarily on their:

 

  1. amino acid sequence.
  2. evolutionary relationships.
  3. secondary structure content and arrangement.
  4. subunit content and arrangement.

 

  1. Protein tertiary and quaternary structures

Pages: 136-138

Proteins are classified within families or superfamilies based on similarities in:

 

  1. evolutionary origin.
  2. physico-chemical properties.
  3. structure and/or function.
  4. subcellular location.
  5. subunit structure.

 

  1. Protein tertiary and quaternary structures

Pages: 138-140    

Which of the following statements about oligomeric proteins is false?

 

  1. A subunit may be similar to other proteins.
  2. All subunits must be identical.
  3. Many have regulatory roles.
  4. Some oligomeric proteins can further associate into large fibers.
  5. Some subunits may have nonprotein prosthetic groups.

 

  1. Protein tertiary and quaternary structures

Page: 138-140      

A repeating structural unit in a multimeric protein is known as a(n):

 

 

  1. Protein tertiary and quaternary structures

Page: 139140     

Which of the following statements concerning rotational symmetry in proteins is false?

 

  1. It involves rotation of proteins inside the cell.
  2. It is frequently seen in the subunits of oligomeric proteins.
  3. It is frequently seen in viruses.
  4. It may involve rotation about one or more axes.
  5. It results in closed, packed structures.

 

  1. Protein denaturation and folding

Pages: 140-141    

An average protein will not be denatured by:

 

  1. a detergent such as sodium dodecyl sulfate.
  2. heating to 90°C.
  3. iodoacetic acid.
  4. pH 10.

 

  1. Protein denaturation and folding

Pages: 140-141

Which of the following is least likely to result in protein denaturation?

 

  1. Altering net charge by changing pH
  2. Changing the salt concentration
  3. Disruption of weak interactions by boiling
  4. Exposure to detergents
  5. Mixing with organic solvents such as acetone

 

  1. Protein denaturation and folding

Page: 141 

Experiments on denaturation and renaturation after the reduction and reoxidation of the —S—S— bonds in the enzyme ribonuclease (RNase) have shown that:

 

  1. folding of denatured RNase into the native, active conformation, requires the input of energy in the form of heat.
  2. native ribonuclease does not have a unique secondary and tertiary structure.
  3. the completely unfolded enzyme, with all —S—S— bonds broken, is still enzymatically active.
  4. the enzyme, dissolved in water, is thermodynamically stable relative to the mixture of amino acids whose residues are contained in RNase.
  5. the primary sequence of RNase is sufficient to determine its specific secondary and tertiary structure.

 

  1. Protein denaturation and folding

Pages: 142143   

Which of the following statements concerning the process of spontaneous folding of proteins is false?

 

  1. It may be an essentially random process.
  2. It may be defective in some human diseases.
  3. It may involve a gradually decreasing range of conformational species.
  4. It may involve initial formation of a highly compact state.
  5. It may involve initial formation of local secondary structure.

 

  1. Protein denaturation and folding

Pages: 144145   

Protein S will fold into its native conformation only when protein Q is also present in the solution.  However, protein Q can fold into its native conformation without protein S.  Protein Q, therefore, may function as a ____________ for protein S.

 

  1. ligand
  2. molecular chaperone
  3. protein precursor
  4. structural motif
  5. supersecondary structural unit

 

 

  1. Protein denaturation and folding

Pages: 144145   

Which of the following is not known to be involved in the process of assisted folding of proteins?

 

  1. Chaperonins
  2. Disulfide interchange
  3. Heat shock proteins
  4. Peptide bond hydrolysis
  5. Peptide bond isomerization

 

Short Answer Questions

 

  1. Overview of protein structure

Page: 113 

Any given protein is characterized by a unique amino acid sequence (primary structure) and three-dimensional (tertiary) structure. How are these related?

 

 

  1. Overview of protein structure

Pages: 114-115, 140-141 

Name four factors (bonds or other forces) that contribute to stabilizing the native structure of a protein, and describe one condition or reagent that interferes with each type of stabilizing force.

 

  1. Overview of protein structure

Pages: 114115   

When a polypeptide is in its native conformation, there are weak interactions between its R groups.  However, when it is denatured there are similar interactions between the protein groups and water.  What then accounts for the greater stability of the native conformation?

 

 

  1. Overview of protein structure

Page: 116 

Draw the resonance structure of a peptide bond, and explain why there is no rotation around the

C—N bond.

 

  1. Overview of protein structure

Page: 116  Difficulty: 1

Pauling and Corey showed that in small peptides, six atoms associated with the peptide bond all lie in a plane.  Draw a dipeptide of two amino acids in trans linkage (side-chains can be shown as —R), and indicate which six atoms are part of the planar structure of the peptide bond.

 

 

  1. Protein secondary structure

Page: 116  Difficulty: 1

Draw the hydrogen bonding typically found between two residues in an a helix.

 

  1. Protein secondary structure

Page: 117-118      

Describe three of the important features of the a-helical polypeptide structure predicted by Pauling and Corey.  Provide one or two sentences for each feature.

 

 

  1. Protein secondary structure

Page: 120 

Describe three of the important features of a b sheet polypeptide structure.  Provide one or two sentences for each feature.

 

 

  1. Protein secondary structure

Page: 120-121      

Why are glycine and proline often found within a b turn?

 

  1. Protein secondary structure

Page: 122, 140-141                      

Explain how circular dichroism spectroscopy could be used to measure the denaturation of a protein.

 

 

  1. Protein tertiary and quaternary structures

Pages: 124125   

In superhelical proteins, such as collagen, several polypeptide helices are intertwined. What is the function of this superhelical twisting?

 

  1. Protein tertiary and quaternary structures

Page: 128 

Why is silk fibroin so strong, but at the same time so soft and flexible?

 

 

 

  1. Protein tertiary and quaternary structures

Page: 130  Difficulty: 1

What is typically found in the interior of a water-soluble globular protein?

 

 

  1. Protein tertiary and quaternary structures

Pages: 132134   

How does one determine the three-dimensional structure of a protein?  Your answer should be more than the name of a technique.

 

  1. Protein tertiary and quaternary structures

Page: 132-134      

Describe a reservation about the use of x-ray crystallography in determining the three-dimensional structures of biological molecules.

 

 

  1. Protein tertiary and quaternary structures

Pages: 135136    Difficulty: 1

Explain what is meant by motifs in protein structure.

 

 

  1. Protein tertiary and quaternary structures

Pages: 136-137    

Draw a bab loop, and describe what is found in the interior of the loop.

 

 

  1. Protein tertiary and quaternary structures

Page: 136  Difficulty: 1

Describe the quaternary structure of hemoglobin.

 

 

  1. Protein tertiary and quaternary structures

Pages: 138140   

Describe briefly the two major types of symmetry found in oligomeric proteins and give an example of each.

 

  1. Protein tertiary and quaternary structures
Pages: 139-140

What is the rationale for many large proteins containing multiple copies of a polypeptide subunit?

 

  1. Protein denaturation and folding

Pages: 141-142    

Explain (succinctly) the theoretical and/or experimental arguments in support of this statement:  “The primary sequence of a protein determines its three-dimensional shape and thus its function.”

 

 

  1. Protein denaturation and folding

Pages: 140-142    

Each of the following reagents or conditions will denature a protein.  For each, describe in one or two sentences what the reagent/condition does to destroy native protein structure.

 

(a)  urea

(b)  high temperature

(c)  detergent

(d)  low pH

 

 

  1. Protein denaturation and folding

Pages: 140-141    

How can changes in pH alter the conformation of a protein?

 

 

  1. Protein denaturation and folding

Pages: 141142   

Once a protein has been denatured, how can it be renatured? If renaturation does not occur, what might be the explanation?

 

 

 

  1. Protein denaturation and folding

Pages: 143145   

What are two mechanisms by which “chaperone” proteins assist in the correct folding of polypeptides?

 

 

 

 

Chapter 5   Protein Function

 

 

 

Multiple Choice Questions

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 153 

The interactions of ligands with proteins:

 

  1. are relatively nonspecific.
  2. are relatively rare in biological systems.
  3. are usually irreversible.
  4. are usually transient.
  5. usually result in the inactivation of the proteins.

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 154 

A prosthetic group of a protein is a non-protein structure that is:

 

  1. a ligand of the protein.
  2. a part of the secondary structure of the protein.
  3. a substrate of the protein.
  4. permanently associated with the protein.
  5. transiently bound to the protein.

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 154155   

When oxygen binds to a heme-containing protein, the two open coordination bonds of Fe2+ are occupied by:

 

  1. one O atom and one amino acid atom.
  2. one O2 molecule and one amino acid atom.
  3. one O2 molecule and one heme atom.
  4. two O atoms.
  5. two O2

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 156 

In the binding of oxygen to myoglobin, the relationship between the concentration of oxygen and the fraction of binding sites occupied can best be described as:

 

  1. linear with a negative slope.
  2. linear with a positive slope.

 

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 155-156    

Which of the following statements about protein-ligand binding is correct?

 

  1. The Ka is equal to the concentration of ligand when all of the binding sites are occupied.
  2. The Ka is independent of such conditions as salt concentration and pH.
  3. The larger the Ka (association constant), the weaker the affinity.
  4. The larger the Ka, the faster is the binding.
  5. The larger the Ka, the smaller the Kd (dissociation constant).

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 159 

Myoglobin and the subunits of hemoglobin have:

 

  1. no obvious structural relationship.
  2. very different primary and tertiary structures.
  3. very similar primary and tertiary structures.
  4. very similar primary structures, but different tertiary structures.
  5. very similar tertiary structures, but different primary structures.

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 161-162    

An allosteric interaction between a ligand and a protein is one in which:

 

  1. binding of a molecule to a binding site affects binding of additional molecules to the same site.
  2. binding of a molecule to a binding site affects binding properties of another site on the protein.
  3. binding of the ligand to the protein is covalent.
  4. multiple molecules of the same ligand can bind to the same binding site.
  5. two different ligands can bind to the same binding site.

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 161 

In hemoglobin, the transition from T state to R state (low to high affinity) is triggered by:

 

  1. Fe2+
  2. heme binding.
  3. oxygen binding.
  4. subunit association.
  5. subunit dissociation.

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 167           

Which of the following is not correct concerning 2,3-bisphosphoglycerate (BPG)?

 

  1. It binds at a distance from the heme groups of hemoglobin.
  2. It binds with lower affinity to fetal hemoglobin than to adult hemoglobin.
  3. It increases the affinity of hemoglobin for oxygen.
  4. It is an allosteric modulator.
  5. It is normally found associated with the hemoglobin extracted from red blood cells.

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 165 

Which of the following is not correct concerning cooperative binding of a ligand to a protein?

 

  1. It is usually a form of allosteric interaction.
  2. It is usually associated with proteins with multiple subunits.
  3. It rarely occurs in enzymes.
  4. It results in a nonlinear Hill Plot.
  5. It results in a sigmoidal binding curve.

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 168-169      

Carbon monoxide (CO) is toxic to humans because:

 

  1. it binds to myoglobin and causes it to denature.
  2. it is rapidly converted to toxic CO2.
  3. it binds to the globin portion of hemoglobin and prevents the binding of O2.
  4. it binds to the Fe in hemoglobin and prevents the binding of O2.
  5. it binds to the heme portion of hemoglobin and causes heme to unbind from hemoglobin.

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 168-169    

The amino acid substitution of Val for Glu in Hemoglobin S results in aggregation of the protein because of ___________ interactions between molecules.

 

  1. covalent
  2. disulfide
  3. hydrogen bonding
  4. hydrophobic
  5. ionic

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 168-169    

The fundamental cause of sickle-cell disease is a change in the structure of:

 

  1. red cells.
  2. the heart.

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins

Pages: 170-171    

An individual molecular structure within an antigen to which an individual antibody binds is as a(n):

 

  1. Fab region.
  2. Fc region
  3. MHC site.

 

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins

Page: 171-172      

Which of the following parts of the IgG molecule are not involved in binding to an antigen?

 

  1. Fab
  2. Fc
  3. Heavy chain
  4. Light chain
  5. Variable domain

 

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins

Page: 173             

A monoclonal antibody differs from a polyclonal antibody in that monoclonal antibodies:

 

  1. are labeled with chemicals that can be visualized.
  2. are produced by cells from the same organism that produced the antigen.
  3. are synthesized by a population of identical, or “cloned,” cells.
  4. are synthesized only in living organisms.
  5. have only a single polypeptide chain that can recognize an antigen.

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Page: 175             

Which of the following generalizations concerning motor proteins is correct?

 

  1. They convert chemical energy into kinetic energy.
  2. They convert chemical energy into potential energy.
  3. They convert kinetic energy into chemical energy.
  4. They convert kinetic energy into rotational energy.
  5. They convert potential energy into chemical energy.

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Page: 175             

The predominant structural feature in myosin molecules is:

 

  1. a b
  2. an a
  3. the Fab domain.
  4. the light chain.
  5. the meromyosin domain.

 

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Page: 177             

The energy that is released by the hydrolysis of ATP by actin is used for:

 

  1. actin filament assembly.
  2. actin filament disassembly.
  3. actin-myosin assembly.
  4. actin-myosin disassembly.
  5. muscle contraction.

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Pages: 177-178                

During muscle contraction, hydrolysis of ATP results in a change in the:

 

  1. conformation of actin.
  2. conformation of myosin.
  3. structure of the myofibrils.
  4. structure of the sarcoplasmic reticulum.
  5. structure of the Z disk.

 

 

Short Answer Questions

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 153  Difficulty: 1

Describe the concept of “induced fit” in ligand-protein binding.

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 154 

Explain why most multicellular organisms use an iron-containing protein for oxygen binding rather than free Fe2+.  Your answer should include an explanation of (a) the role of heme and (b) the role of the protein itself.

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 155157   

Describe how you would determine the Ka (association constant) for a ligand and a protein.

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins
Page: 163-164       Difficulty: 1

Why is carbon monoxide (CO) toxic to aerobic organisms?

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 156 

For the binding of a ligand to a protein, what is the relationship between the Ka (association constant), the Kd (dissociation constant), and the affinity of the protein for the ligand?

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 156 

What fraction of ligand binding sites are occupied (q) when [ligand] = Kd?  Show your work.

 

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 158 

Explain briefly why the relative affinity of heme for oxygen and carbon monoxide is changed by the presence of the myoglobin protein.

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 156, 161   

Explain why the structure of myoglobin makes it function well as an oxygen-storage protein whereas the structure of hemoglobin makes it function well as an oxygen-transport protein.

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 162165   

Describe briefly the two principal models for the cooperative binding of ligands to proteins with multiple binding sites

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Page: 167 

How does BPG binding to hemoglobin decrease its affinity for oxygen?

 

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins
Page: 166
  1. a) What is the effect of pH on the binding of oxygen to hemoglobin (the Bohr Effect)? (b) Briefly describe the mechanism of this effect.

 

  1. Reversible binding of a protein to a ligand: oxygen-binding proteins

Pages: 168-169    

Explain how the effects of sickle cell disease demonstrate that hemoblobin undergoes a conformational change upon releasing oxygen.

 

 

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins
Page: 170  Difficulty: 1

Why is it likely that the immune system can produce a specific antibody that can recognize and bind to any specific chemical structure?

 

 

 

 

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins

Page: 171 

Describe briefly the basic structure of an IgG protein molecule.

 

 

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins

Page: 173 

What is the chemical basis for the specificity of binding of an immunoglobin antibody to a particular antigen?

 

 

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins

Page: 173 

What is the concept of “induced fit” as it applies to antigen-antibody binding?

 

 

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins

Page: 173 

Describe how immunoaffinity chromatography is performed.

 

 

  1. Complementary interactions between proteins and ligands: the immune system and immunoglobulins

Pages: 173175   

What properties of antibodies make them useful biochemical reagents?  Describe one biochemical application of antibodies (with more than just the name of the technique).

 

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Page: 175 

Describe briefly the structure of myosin.

 

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Page: 176  Difficulty: 1

What is the relationship between G-actin and F-actin?

 

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Page: 178 

What is the role of ATP and ATP hydrolysis in the cycle of actin-myosin association and disassociation that leads to muscle contraction?

 

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Page: 178 

Describe the cycle of actin-myosin association and disassociation that leads to muscle contraction.

 

  1. Protein interactions modulated by chemical energy: actin, myosin, and molecular motors

Page: 177-179      

Although the myosin molecule “walks” along actin in discrete steps, you are aboe to make smooth motions using your muscles.  Explain how this is possible.

 

 

 

Chapter 6   Enzymes

 

 

 

Multiple Choice Questions

 

  1. An introduction to enzymes

Pages: 183-184

One of the enzymes involved in glycolysis, aldolase, requires Zn2+ for catalysis.  Under conditions of zinc deficiency, when the enzyme may lack zinc, it would be referred to as the:

 

  1. prosthetic group.

 

  1. An introduction to enzymes

Page: 185 

Which one of the following is not among the six internationally accepted classes of enzymes?

 

  1. Hydrolases
  2. Ligases
  3. Oxidoreductases
  4. Polymerases
  5. Transferases

 

  1. How enzymes work

Pages: 186-187    

Enzymes are potent catalysts because they:

 

  1. are consumed in the reactions they catalyze.
  2. are very specific and can prevent the conversion of products back to substrates.
  3. drive reactions to completion while other catalysts drive reactions to equilibrium.
  4. increase the equilibrium constants for the reactions they catalyze.
  5. lower the activation energy for the reactions they catalyze.

 

  1. How enzymes work

Pages: 186-187    

The role of an enzyme in an enzyme-catalyzed reaction is to:

 

  1. bind a transition state intermediate, such that it cannot be converted back to substrate.
  2. ensure that all of the substrate is converted to product.
  3. ensure that the product is more stable than the substrate.
  4. increase the rate at which substrate is converted into product.
  5. make the free-energy change for the reaction more favorable.

 

 

 

 

 

  1. How enzymes work

Pages: 186-188     Ans:D

Which one of the following statements is true of enzyme catalysts?

 

  1. Their catalytic activity is independent of pH.
  2. They are generally equally active on D and L isomers of a given substrate.
  3. They can increase the equilibrium constant for a given reaction by a thousand fold or more.
  4. They can increase the reaction rate for a given reaction by a thousand fold or more.
  5. To be effective, they must be present at the same concentration as their substrate.

 

  1. How enzymes work

Pages: 186-188    

Which one of the following statements is true of enzyme catalysts?

 

  1. They bind to substrates, but are never covalently attached to substrate or product.
  2. They increase the equilibrium constant for a reaction, thus favoring product formation.
  3. They increase the stability of the product of a desired reaction by allowing ionizations, resonance, and isomerizations not normally available to substrates.
  4. They lower the activation energy for the conversion of substrate to product.
  5. To be effective they must be present at the same concentration as their substrates.

 

  1. How enzymes work

Pages: 186-188    

Which of the following statements is false?

 

  1. A reaction may not occur at a detectable rate even though it has a favorable equilibrium.
  2. After a reaction, the enzyme involved becomes available to catalyze the reaction again.
  3. For S ® P, a catalyst shifts the reaction equilibrium to the right.
  4. Lowering the temperature of a reaction will lower the reaction rate.
  5. Substrate binds to an enzyme’s active site.

 

  1. How enzymes work

Pages: 189-190                

Enzymes differ from other catalysts in that only enzymes:

 

  1. are not consumed in the reaction.
  2. display specificity toward a single reactant.
  3. fail to influence the equilibrium point of the reaction.
  4. form an activated complex with the reactants.
  5. lower the activation energy of the reaction catalyzed.

 

 

 

 

 

 

 

 

 

 

  1. How enzymes work

Page: 190 

Compare the two reaction coordinate diagrams below and select the answer that correctly describes their relationship.  In each case, the single intermediate is the ES complex.

 

 

 

  1. (a) describes a strict “lock and key” model, whereas (b) describes a transition-state complementarity model.
  2. The activation energy for the catalyzed reaction is #5 in (a) and is #7 in (b).
  3. The activation energy for the uncatalyzed reaction is given by #5 + #6 in (a) and by #7 + #4 in (b).
  4. The contribution of binding energy is given by #5 in (a) and by #7 in (b).
  5. The ES complex is given by #2 in (a) and #3 in (b).

 

  1. How enzymes work

Pages: 190-191    

Which of the following is true of the binding energy derived from enzyme-substrate interactions?

 

  1. It cannot provide enough energy to explain the large rate accelerations brought about by enzymes.
  2. It is sometimes used to hold two substrates in the optimal orientation for reaction.
  3. It is the result of covalent bonds formed between enzyme and substrate.
  4. Most of it is derived from covalent bonds between enzyme and substrate.
  5. Most of it is used up simply binding the substrate to the enzyme.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 192 

The concept of “induced fit” refers to the fact that:

 

  1. enzyme specificity is induced by enzyme-substrate binding.
  2. enzyme-substrate binding induces an increase in the reaction entropy, thereby catalyzing the reaction.
  3. enzyme-substrate binding induces movement along the reaction coordinate to the transition state.
  4. substrate binding may induce a conformational change in the enzyme, which then brings catalytic groups into proper orientation.
  5. when a substrate binds to an enzyme, the enzyme induces a loss of water (desolvation) from the substrate.
  6. Enzyme kinetics as an approach to understanding mechanism

Pages: 192-193

In the following diagram of the first step in the reaction catalyzed by the protease chymotrypsin, the process of general base catalysis is illustrated by the number ________, and the process of covalent catalysis is illustrated by the number _________.

 

 

  1. 1; 2
  2. 1; 3
  3. 2; 3
  4. 2; 3
  5. 3; 2

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 194 

The benefit of measuring the initial rate of a reaction V0 is that at the beginning of a reaction:

 

  1. [ES] can be measured accurately.
  2. changes in [S] are negligible, so [S] can be treated as a constant.
  3. changes in Km are negligible, so Km can be treated as a constant.
  4. V0 = Vmax.
  5. varying [S] has no effect on V0.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 195-199                

Which of the following statements about a plot of V0 vs. [S] for an enzyme that follows Michaelis-Menten kinetics is false?

 

  1. As [S] increases, the initial velocity of reaction V0 also increases.
  2. At very high [S], the velocity curve becomes a horizontal line that intersects the y-axis at Km.
  3. Km is the [S] at which V0 = 1/2 Vmax.
  4. The shape of the curve is a hyperbola.
  5. The y-axis is a rate term with units of mm/min.

 

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 196 

Michaelis and Menten assumed that the overall reaction for an enzyme-catalyzed reaction could be written as

k1            k2

E + S                          ES  ®  E + P

k-1

 

Using this reaction, the rate of breakdown of the enzyme-substrate complex can be described by the expression:

 

  1. k1 ([Et] – [ES]).
  2. k1 ([Et] – [ES])[S].
  3. k2 [ES].
  4. k-1 [ES] + k2 [ES].
  5. k-1 [ES].

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 196 

The steady state assumption, as applied to enzyme kinetics, implies:

 

  1. Km = Ks.
  2. the enzyme is regulated.
  3. the ES complex is formed and broken down at equivalent rates.
  4. the Km is equivalent to the cellular substrate concentration.
  5. the maximum velocity occurs when the enzyme is saturated.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-199                

An enzyme-catalyzed reaction was carried out with the substrate concentration initially a thousand times greater than the Km for that substrate.  After 9 minutes, 1% of the substrate had been converted to product, and the amount of product formed in the reaction mixture was 12 mmol.  If, in a separate experiment, one-third as much enzyme and twice as much substrate had been combined, how long would it take for the same amount (12 mmol) of product to be formed?

 

  1. 5 min
  2. 5 min
  3. 27 min
  4. 3 min
  5. 6 min

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-201                

Which of these statements about enzyme-catalyzed reactions is false?

 

  1. At saturating levels of substrate, the rate of an enzyme-catalyzed reaction is proportional to the enzyme concentration.
  2. If enough substrate is added, the normal Vmax of a reaction can be attained even in the presence of a competitive inhibitor.
  3. The rate of a reaction decreases steadily with time as substrate is depleted.
  4. The activation energy for the catalyzed reaction is the same as for the uncatalyzed reaction, but the equilibrium constant is more favorable in the enzyme-catalyzed reaction.
  5. The Michaelis-Menten constant Km equals the [S] at which V = 1/2 Vmax.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 197

The following data were obtained in a study of an enzyme known to follow Michaelis-Menten kinetics:

V0               Substrate added

(mmol/min)            (mmol/L)

—————————————

217                           0.8

325                           2

433                           4

488                           6

647                    1,000

—————————————

 

The Km for this enzyme is approximately:

 

  1. 1 mM.
  2. 1,000 mM.
  3. 2 mM.
  4. 4 mM.
  5. 6 mM.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 196-197      

For enzymes in which the slowest (rate-limiting) step is the reaction

k2

ES  ®  P

 

Km becomes equivalent to:

 

  1. kcat.
  2. the [S] where V0 = Vmax.
  3. the dissociation constant, Kd, for the ES complex.
  4. the maximal velocity.
  5. the turnover number.

 

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 197 

The Lineweaver-Burk plot is used to:

 

  1. determine the equilibrium constant for an enzymatic reaction.
  2. extrapolate for the value of reaction rate at infinite enzyme concentration.
  3. illustrate the effect of temperature on an enzymatic reaction.
  4. solve, graphically, for the rate of an enzymatic reaction at infinite substrate concentration.
  5. solve, graphically, for the ratio of products to reactants for any starting substrate concentration.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 197             

The double-reciprocal transformation of the Michaelis-Menten equation, also called the Lineweaver-Burk plot, is given by

1/V0 = Km /(Vmax[S]) + 1/Vmax.

To determine Km from a double-reciprocal plot, you would:

 

  1. multiply the reciprocal of the x-axis intercept by –
  2. multiply the reciprocal of the y-axis intercept by –
  3. take the reciprocal of the x-axis intercept.
  4. take the reciprocal of the y-axis intercept.
  5. take the x-axis intercept where V0 = 1/2 Vmax.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 198 

To calculate the turnover number of an enzyme, you need to know:

 

  1. the enzyme concentration.
  2. the initial velocity of the catalyzed reaction at [S] >> Km.
  3. the initial velocity of the catalyzed reaction at low [S].
  4. the Km for the substrate.
  5. both A and B.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 198 

The number of substrate molecules converted to product in a given unit of time by a single enzyme molecule at saturation is referred to as the:

 

  1. dissociation constant.
  2. half-saturation constant.
  3. maximum velocity.
  4. Michaelis-Menten number.
  5. turnover number.

 

 

 

 

 

 

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 201-202                

In a plot of l/V against 1/[S] for an enzyme-catalyzed reaction, the presence of a competitive inhibitor will alter the:

 

  1. curvature of the plot.
  2. intercept on the l/[S] axis.
  3. intercept on the l/V
  4. pK of the plot.
  5. Vmax.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 201-202    

In competitive inhibition, an inhibitor:

 

  1. binds at several different sites on an enzyme.
  2. binds covalently to the enzyme.
  3. binds only to the ES complex.
  4. binds reversibly at the active site.
  5. lowers the characteristic Vmax of the enzyme.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 201-205                

Vmax for an enzyme-catalyzed reaction:

 

  1. generally increases when pH increases.
  2. increases in the presence of a competitive inhibitor.
  3. is limited only by the amount of substrate supplied.
  4. is twice the rate observed when the concentration of substrate is equal to the Km.
  5. is unchanged in the presence of a uncompetitive inhibitor.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 204

Enzyme X exhibits maximum activity at pH = 6.9.  X shows a fairly sharp decrease in its activity when the pH goes much lower than 6.4.  One likely interpretation of this pH activity is that:

 

  1. a Glu residue on the enzyme is involved in the reaction.
  2. a His residue on the enzyme is involved in the reaction.
  3. the enzyme has a metallic cofactor.
  4. the enzyme is found in gastric secretions.
  5. the reaction relies on specific acid-base catalysis.

 

 

  1. Examples of enzymatic reactions

Pages: 203-204                

Phenyl-methane-sulfonyl-fluoride (PMSF) inactivates serine proteases by binding covalently to the catalytic serine residue at the active site; this enzyme-inhibitor bond is not cleaved by the enzyme.  This is an example of what kind of inhibition?

 

  1. irreversible
  2. competitive
  3. non-competitive
  4. mixed
  5. pH inhibition

 

  1. Examples of enzymatic reactions

Page: 212 

Both water and glucose share an —OH that can serve as a substrate for a reaction with the terminal phosphate of ATP catalyzed by hexokinase.  Glucose, however, is about a million times more reactive as a substrate than water.  The best explanation is that:

 

  1. glucose has more —OH groups per molecule than does water.
  2. the larger glucose binds better to the enzyme; it induces a conformational change in hexokinase that brings active-site amino acids into position for catalysis.
  3. the —OH group of water is attached to an inhibitory H atom, while the glucose —OH group is attached to C.
  4. water and the second substrate, ATP, compete for the active site resulting in a competitive inhibition of the enzyme.
  5. water normally will not reach the active site because it is hydrophobic.

 

  1. Examples of enzymatic reactions

Pages: 210-211    

A good transition-state analog:

 

  1. binds covalently to the enzyme.
  2. binds to the enzyme more tightly than the substrate.
  3. binds very weakly to the enzyme.
  4. is too unstable to isolate.
  5. must be almost identical to the substrate.

 

  1. Examples of enzymatic reactions

Pages: 210-211    

A transition-state analog:

 

  1. is less stable when binding to an enzyme than the normal substrate.
  2. resembles the active site of general acid-base enzymes.
  3. resembles the transition-state structure of the normal enzyme-substrate complex.
  4. stabilizes the transition state for the normal enzyme-substrate complex.
  5. typically reacts more rapidly with an enzyme than the normal substrate.

 

 

  1. Examples of enzymatic reactions

Page: 213

The role of the metal ion (Mg2+) in catalysis by enolase is to

 

  1. act as a general acid catalyst
  2. act as a general base catalyst
  3. facilitate general acid catalysis
  4. facilitate general base catalysis
  5. stabilize protein conformation

 

  1. Examples of enzymatic reactions

Page: 216-217      

Penicillin and related drugs inhibit the enzyme      ; this enzyme is produced by               .

 

  1. b-lacamase; bacteria
  2. transpeptidase; human cells
  3. transpeptidase; bacteria
  4. lysozyme; human cells
  5. aldolase; bacteria

 

  1. Regulatory enzymes

Pages: 220-221    

Which of the following statements about allosteric control of enzymatic activity is false?

 

  1. Allosteric effectors give rise to sigmoidal V0 [S] kinetic plots.
  2. Allosteric proteins are generally composed of several subunits.
  3. An effector may either inhibit or activate an enzyme.
  4. Binding of the effector changes the conformation of the enzyme molecule.
  5. Heterotropic allosteric effectors compete with substrate for binding sites.

 

  1. Regulatory enzymes

Pages: 220-221    

A small molecule that decreases the activity of an enzyme by binding to a site other than the catalytic site is termed a(n):

 

  1. allosteric inhibitor.
  2. alternative inhibitor.
  3. competitive inhibitor.
  4. stereospecific agent.
  5. transition-state analog.

 

  1. Regulatory enzymes

Pages: 220-221    

Allosteric enzymes:

 

  1. are regulated primarily by covalent modification.
  2. usually catalyze several different reactions within a metabolic pathway.
  3. usually have more than one polypeptide chain.
  4. usually have only one active site.
  5. usually show strict Michaelis-Menten kinetics.

 

  1. Regulatory enzymes

Pages: 221-222    

A metabolic pathway proceeds according to the scheme, R ® S ® T ® U ® V ® W.  A regulatory enzyme, X, catalyzes the first reaction in the pathway.  Which of the following is most likely correct for this pathway?

 

  1. Either metabolite U or V is likely to be a positive modulator, increasing the activity of X.
  2. The first product S, is probably the primary negative modulator of X, leading to feedback inhibition.
  3. The last product, W, is likely to be a negative modulator of X, leading to feedback inhibition.
  4. The last product, W, is likely to be a positive modulator, increasing the activity of X.
  5. The last reaction will be catalyzed by a second regulatory enzyme.

 

  1. Regulatory enzymes

Pages: 223-226                

Which of the following has not been shown to play a role in determining the specificity of protein kinases?

 

  1. Disulfide bonds near the phosphorylation site
  2. Primary sequence at phosphorylation site
  3. Protein quaternary structure
  4. Protein tertiary structure
  5. Residues near the phosphorylation site

 

  1. Regulatory enzymes

Page: 226 

How is trypsinogen converted to trypsin?

 

  1. A protein kinase-catalyzed phosphorylation converts trypsinogen to trypsin.
  2. An increase in Ca2+ concentration promotes the conversion.
  3. Proteolysis of trypsinogen forms trypsin.
  4. Trypsinogen dimers bind an allosteric modulator, cAMP, causing dissociation into active trypsin monomers.
  5. Two inactive trypsinogen dimers pair to form an active trypsin tetramer.

 

 

Short Answer Questions

 

  1. An introduction to enzymes

Page: 184  Difficulty: 1

Define the terms “cofactor” and “coenzyme.”

 

 

 

  1. How enzymes work

Page: 187 

Draw and label a reaction coordinate diagram for an uncatalyzed reaction, S ® P, and the same reaction catalyzed by an enzyme, E.

 

 

  1. How enzymes work

Page: 187  Difficulty: 1

The difference in (standard) free energy content, DG’°, between substrate S and product P may vary considerably among different reactions.  What is the significance of these differences?

 

 

  1. How enzymes work

Page: 187 

For a reaction that can take place with or without catalysis by an enzyme, what would be the effect of the enzyme on the:

(a) standard free energy change of the reaction?

(b) activation energy of the reaction?

(c) initial velocity of the reaction?

(d) equilibrium constant of the reaction?

 

 

  1. How enzymes work

Pages: 187-188    

Sometimes the difference in (standard) free-energy content, DG’°, between a substrate S and a product P is very large, yet the rate of chemical conversion, S ® P, is quite slow. Why?

 

 

  1. How enzymes work

Page: 188 

Write an equilibrium expression for the reaction S ® P and briefly explain the relationship between the value of the equilibrium constant and free energy.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 192-193    

What is the difference between general acid-base catalysis and specific acid-base catalysis?  (Assume that the solvent is water.)

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 194-195    

Michaelis-Menten kinetics is sometimes referred to as “saturation” kinetics.  Why?

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 195-197    

Two different enzymes are able to catalyze the same reaction, A ® B.  They both have the same Vmax, but differ their Km the substrate A.  For enzyme 1, the Km is 1.0 mM; for enzyme 2, the Km is 10 mM.  When enzyme 1 was incubated with 0.1 mM A, it was observed that B was produced at a rate of 0.0020 mmoles/minute. a) What is the value of the Vmax of the enzymes? b) What will be the rate of production of B when enzyme 2 is incubated with 0.1 mM A?  c) What will be the rate of production of B when enzyme 1 is incubated with 1 M (i.e., 1000 mM) A?

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-197    

An enzyme can catalyze a reaction with either of two substrates, S1 or S2.  The Km for S1 was found to be 2.0 mM, and the Km, for S2 was found to be 20 mM.  A student determined that the Vmax was the same for the two substrates.  Unfortunately, he lost the page of his notebook and needed to know the value of Vmax.  He carried out two reactions: one with 0.1 mM S1, the other with 0.1 mM S2.  Unfortunately, he forgot to label which reaction tube contained which substrate. Determine the value of Vmax from the results he obtained:

 

Tube number            Rate of formation of product

  • 5
  • 8

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-198    

Write out the equation that describes the mechanism for enzyme action used as a model by Michaelis and Menten.  List the important assumptions used by Michaelis and Menten to derive a rate equation for this reaction.

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-198    

For the reaction E + S ® ES ® P the Michaelis-Menten constant, Km, is actually a summary of three terms.  What are they?  How is Km determined graphically?

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-198    

An enzyme catalyzes a reaction at a velocity of 20 mmol/min when the concentration of substrate (S) is 0.01 M.  The Km for this substrate is 1 ´ 10-5 M. Assuming that Michaelis-Menten kinetics are followed, what will the reaction velocity be when the concentration of S is (a) 1 ´ 10-5 M and (b) 1 ´ 10-6 M?

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 198, 222   

Give the Michaelis-Menten equation and define each term in it.  Does this equation apply to all enzymes?  If not, to which kind does it not apply?

 

.

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-197    

A biochemist obtains the following set of data for an enzyme that is known to follow Michaelis-Menten kinetics.

 

Substrate                    Initial

concentration               velocity

(mM)                   (mmol/min)

—————————————

1                          49

2                          96

8                        349

50                        621

100                        676

1,000                        698

5,000                        699

—————————————

 

  • Vmax for the enzyme is __________. Explain in one sentence how you determined Vmax.  (b) Km for the enzyme is _________.  Explain in one sentence how you determined Km.

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 197 

Why is the Lineweaver-Burk (double reciprocal) plot (see Box 6, p. 206) more useful than the standard V vs. [S] plot in determining kinetic constants for an enzyme?  (Your answer should probably show typical plots.)

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-197    

An enzyme catalyzes the reaction A ® B.  The initial rate of the reaction was measured as a function of the concentration of A.  The following data were obtained:

 

[A], micromolar     V0, nmoles/min

0.05                    0.08

0.1                      0.16

0.5                      0.79

1                         1.6

5                         7.3

10                       13

50                       40

100                       53

500                       73

1,000                       76

5,000                       79

10,000                       80

20,000                       80

 

  1. What is the Km of the enzyme for the substrate A?
  2. What is the value of V0 when [A] = 43?

The above data was plotted as 1/ V0 vs. 1/[A], and a straight line was obtained.

  1. What is the value of the y-intercept of the line?
  2. What is the value of the x-intercept of the line?

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 196-197    

The turnover number for an enzyme is known to be 5,000 min-1. From the following set of data, calculate the Km and the total amount of enzyme present in these experiments.

 

Substrate              Initial

concentration         velocity

(mM)            (mmol/min)

1                  167

2                  250

4                  334

6                  376

100                  498

1,000                  499

 

  • Km = __________. (b) Total enzyme = __________ m

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 198 

When 10 mg of an enzyme of Mr 50,000 is added to a solution containing its substrate at a concentration one hundred times the Km, it catalyzes the conversion of 75 mmol of substrate into product in 3 min.  What is the enzyme’s turnover number?

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 198 

Fifteen mg of an enzyme of Mr 30,000 working at Vmax catalyzes the conversion of 60 mmol of substrate into product in 3 min.  What is the enzyme’s turnover number?

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Page: 198 

How does the total enzyme concentration affect turnover number and Vmax?

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 198-199    

Enzymes with a kcat / Km ratio of about 108 M-1s-1 are considered to show optimal catalytic efficiency.  Fumarase, which catalyzes the reversible-dehydration reaction

fumarate + H2O            malate

has a ratio of turnover number to the Michaelis-Menten constant, (kcat / Km) of 1.6 ´ 108 for the substrate fumarate and 3.6 ´ 107 for the substrate malate.  Because the turnover number for both substrates is nearly identical, what factors might be involved that explain the different ratio for the two substrates?

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 202-203    

Methanol (wood alcohol) is highly toxic because it is converted to formaldehyde in a reaction catalyzed by the enzyme alcohol dehydrogenase:

 

NAD+ + methanol ® NADH + H+ + formaldehyde

 

Part of the medical treatment for methanol poisoning is to administer ethanol (ethyl alcohol) in amounts large enough to cause intoxication under normal circumstances.  Explain this in terms of what you know about examples of enzymatic reactions.

 

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 202-203                

You measure the initial rate of an enzyme reaction as a function of substrate concentration in the presence and absence of an inhibitor.  The following data are obtained:

 

[S]                             V0

-Inhibitor    +Inhibitor

0.0001                 33                17

0.0002                 50                29

0.0005                 71                50

0.001                   83                67

0.002                   91                80

0.005                   96                91

0.01                     98                95

0.02                     99                98

0.05                   100                99

0.1                     100              100

0.2                     100              100

  1. a) What is the Vmax in the absence of inhibitor?
  2. b) What is the Km in the absence of inhibitor?
  3. c) When [S] = 0.0004, what will V0 be in the absence of inhibitor?
  4. d) When [S] =0.0004, what will V0 be in the presence of inhibitor?
  5. e) What kind of inhibitor is it likely to be?

 

  1. Enzyme kinetics as an approach to understanding mechanism

Pages: 202-203    

An enzyme follows Michaelis-Menten kinetics.  Indicate (with an “x”) which of the kinetic parameters at the left would be altered by the following factors.  Give only one answer for each.

 

 

 

 

 

  1. Examples of enzymatic reactions

Pages: 207, 213-216        

The enzymatic activity of lysozyme is optimal at pH 5.2 and decreases above and below this pH value.  Lysozyme contains two amino acid residues in the active site essential for catalysis: Glu35 and Asp52.  The pK value for the carboxyl side chains of these two residues are 5.9 and 4.5, respectively.  What is the ionization state of each residue at the pH optimum of lysozyme?  How can the ionization states of these two amino acid residues explain the pH-activity profile of lysozyme?

 

  1. Examples of enzymatic reactions

Page: 207 

Why does pH affect the activity of an enzyme?

 

  1. Examples of enzymatic reactions

Pages: 208-209    

Chymotrypsin belongs to a group of proteolytic enzymes called the “serine proteases,” many of which have an Asp, His, and Ser residue that are crucial to the catalytic mechanism.  The serine hydroxyl functions as a nucleophile.  What do the other two amino acids do to support this nucleophilic reaction?

 

  1. Examples of enzymatic reactions

Pages: 208-209    

For serine to work effectively as a nucleophile in covalent catalysis in chymotrypsin a nearby amino acid, histidine, must serve as general base catalyst.  Briefly describe, in words, how these two amino acids work together.

 

 

  1. Examples of enzymatic reactions

Pages: 216-217    

Penicillin and related antibiotics contain a 4-membered b-lactam ring.  Explain why this feature is important to the mechanism of action of these drugs.

 

 

  1. Regulatory enzymes

Page: 212 

On the enzyme hexokinase, ATP reacts with glucose to produce glucose 6-phosphate and ADP five orders of magnitude faster than ATP reacts with H2O to form phosphate and ADP.  The intrinsic chemical reactivity of the —OH group in water is about the same as that of the glucose molecule, and water can certainly fit into the active site.  Explain this rate differential in two sentences or less.

 

 

  1. Examples of enzymatic reactions

Pages: 210-211    

Why is a transition-state analog not necessarily the same as a competitive inhibitor?

 

  1. Regulatory enzymes

Pages: 220-221     Difficulty: 1

The scheme S ® T ® U ® V ® W ® X ® Y represents a hypothetical pathway for the metabolic synthesis of compound Y.  The pathway is regulated by feedback inhibition.  Indicate where the inhibition is most likely to occur and what the likely inhibitor is.

 

  1. Regulatory enzymes

Pages: 220-221    

Explain how a biochemist might discover that a certain enzyme is allosterically regulated.

 

 

  1. Regulatory enzymes

Pages: 226-227    

What is a zymogen (proenzyme)?  Explain briefly with an example.

 

 

 

Chapter 7   Carbohydrates and Glycobiology

 

 

 

Multiple Choice Questions

 

  1. Monosaccharides and disaccharides

Page: 236 

To possess optical activity, a compound must be:

 

  1. a carbohydrate.
  2. a hexose.
  3. D-glucose.

 

  1. Monosaccharides and disaccharides

Page: 237 

Which of the following monosaccharides is not an aldose?

 

  1. erythrose
  2. fructose
  3. glucose
  4. glyceraldehyde
  5. ribose

 

  1. Monosaccharides and disaccharides

Page: 236 

The reference compound for naming D and L isomers of sugars is:

 

 

  1. Monosaccharides and disaccharides

Page: 238 

When two carbohydrates are epimers:

 

  1. one is a pyranose, the other a furanose.
  2. one is an aldose, the other a ketose.
  3. they differ in length by one carbon.
  4. they differ only in the configuration around one carbon atom.
  5. they rotate plane-polarized light in the same direction.

 

 

 

 

 

  1. Monosaccharides and disaccharides

Page: 238 

Which of the following is an epimeric pair?

 

  1. D-glucose and D-glucosamine
  2. D-glucose and D-mannose
  3. D-glucose and L-glucose
  4. D-lactose and D-sucrose
  5. L-mannose and L-fructose

 

  1. Monosaccharides and disaccharides

Page: 239 

Which of following is an anomeric pair?

 

  1. D-glucose and D-fructose
  2. D-glucose and L-fructose
  3. D-glucose and L-glucose
  4. a-D-glucose and b-D-glucose
  5. a-D-glucose and b-L-glucose

 

  1. Monosaccharides and disaccharides

Page: 239 

When the linear form of glucose cyclizes, the product is a(n):

 

 

  1. Monosaccharides and disaccharides

Page: 239 

Which of the following pairs is interconverted in the process of mutarotation?

 

  1. D-glucose and D-fructose
  2. D-glucose and D-galactose
  3. D-glucose and D-glucosamine
  4. D-glucose and L-glucose
  5. a-D-glucose and b-D-glucose

 

  1. Monosaccharides and disaccharides

Page: 241 

Which of the following is not a reducing sugar?

 

  1. Fructose
  2. Glucose
  3. Glyceraldehyde
  4. Ribose
  5. Sucrose

 

 

  1. Monosaccharides and disaccharides

Pages: 240-241    

Which of the following monosaccharides is not a carboxylic acid?

 

  1. 6-phospho-gluconate
  2. gluconate
  3. glucose
  4. glucuronate
  5. muramic acid

 

  1. Monosaccharides and disaccharides

Page: 241 

D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon.  One of the products of this reaction is:

 

  1. D-galactose.
  2. D-gluconate.
  3. D-glucuronate.
  4. D-ribose.
  5. muramic acid.

 

  1. Monosaccharides and disaccharides

Pages: 241-242    

Hemoglobin glycation is a process where               is                      attached to hemoglobin.

 

  1. glycerol; covalently
  2. glucose; enzymatically
  3. glucose; non-enzymatically
  4. N-acetyl-galactosamine; enzymatically
  5. galactose; non-enzymatically

 

  1. Monosaccharides and disaccharides

Page: 243 

From the abbreviated name of the compound Gal(b1 ® 4)Glc, we know that:

 

  1. C-4 of glucose is joined to C-1 of galactose by a glycosidic bond.
  2. the compound is a D-enantiomer.
  3. the galactose residue is at the reducing end.
  4. the glucose is in its pyranose form.
  5. the glucose residue is the b

 

  1. Polysaccharides

Pages: 245-246    

Starch and glycogen are both polymers of:

 

  1. glucose1-phosphate.
  2. a-D-glucose.
  3. b-D-glucose.

 

  1. Polysaccharides

Pages: 245-246    

Which of the following statements about starch and glycogen is false?

 

  1. Amylose is unbranched; amylopectin and glycogen contain many (a1 ® 6) branches.
  2. Both are homopolymers of glucose.
  3. Both serve primarily as structural elements in cell walls.
  4. Both starch and glycogen are stored intracellularly as insoluble granules.
  5. Glycogen is more extensively branched than starch.

 

  1. Polysaccharides

Pages: 244-250    

Which of the following is a heteropolysaccharide?

 

  1. Cellulose
  2. Chitin
  3. Glycogen
  4. Hyaluronate
  5. Starch

 

  1. Glycoconjugates: proteoglycans, glycoproteins, and glycolipids

Page: 252 

The basic structure of a proteoglycan consists of a core protein and a:

 

 

  1. Glycoconjugates: proteoglycans, glycoproteins, and glycolipids

Pagse: 255-256    

In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues:

 

  1. asparagine, serine, or threonine.
  2. aspartate or glutamate.
  3. glutamine or arginine.
  4. glycine, alanine, or aspartate.
  5. tryptophan, aspartate, or cysteine.

 

  1. Glycoconjugates: proteoglycans, glycoproteins, and glycolipids

Page: 257 

Which of the following is a dominant feature of the outer membrane of the cell wall of gram negative bacteria?

 

  1. Amylose
  2. Cellulose
  3. Glycoproteins
  4. Lipopolysaccharides
  5. Lipoproteins

 

  1. Carbohydrates as informational molecules: the sugar code

Page: 258 

The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to:

 

  1. amphipathic molecules.
  2. hydrophobic molecules.
  3. specific lipids.
  4. specific oligosaccharides.
  5. specific peptides.

 

  1. Carbohydrates as informational molecules: the sugar code

Page: 262 

Why is it surprising that the side chains of tryptophan residues in proteins can interact with lectins?

 

  1. because the side chain of tryptophan is hydrophilic and lectins are hydrophobic.
  2. because the side chain of tryptophan is (-) charged and lectins are generally (+) charged or neutral.
  3. because the side chain of tryptophan can make hydrogen bonds and lectins cannot.
  4. because the side chain of tryptophan is hydrophobic and lectins are generally hydrophilic.
  5. none of the above.

 

Short Answer Questions

 

  1. Monosaccharides and disaccharides

Page: 235 

Explain why all mono- and disaccharides are soluble in water.

 

 

  1. Monosaccharides and disaccharides

Pages: 236-238    

This compound is L-glyceraldehyde.  Draw a stereochemically correct representation of C-1 and C-2 of D-glucose.

 

CHO

|

HO—C—H

|

CH2OH

 

 

 

  1. Monosaccharides and disaccharides

Page: 237 

Categorize each of the following as an aldose, a ketose, or neither.

 

 

 

  1. Monosaccharides and disaccharides

Pages: 236-243    

Define each in 20 words or less:

(a) anomeric carbon;

(b) enantiomers;

(c) furanose and pyranose;

(d) glycoside;

(e) epimers;

(f) aldose and ketose.

 

 

  1. Monosaccharides and disaccharides

Pages: 236-241    

  • Draw the structure of any aldohexose in the pyranose ring form. (b) Draw the structure of the anomer of the aldohexose you drew above. (c) How many asymmetric carbons (chiral centers) does each of these structures have? (d) How many stereoisomers of the aldohexoses you drew are theoretically possible?

 

 

  1. Monosaccharides and disaccharides

Pages: 240-244    

In the following structure:

 

 

(a) How many of the monosaccharide units are furanoses and how may are pyranoses?  (b) What is the linkage between the two monosaccharide units?  (c) Is this a reducing sugar?

Explain.

 

 

  1. Monosaccharides and disaccharides

Pages: 241-244    

  • Define “reducing sugar.” (b) Sucrose is a disaccharide composed of glucose and fructose

(Glc(a1 ® 2)Fru).  Explain why sucrose is not a reducing sugar, even though both glucose and fructose are.

 

 

  1. Polysaccharides

Pages: 243-252    

Match these molecules with their biological roles.

(a) glycogen               __ viscosity, lubrication of extracellular secretions

(b) starch                    __ carbohydrate storage in plants

(c) trehalose               __ transport/storage in insects

(d) chitin                    __ exoskeleton of insects

(e) cellulose                __ structural component of bacterial cell wall

(f) peptidoglycan        __ structural component of plant cell walls

(g) hyaluronate           __ extracellular matrix of animal tissues

(h) proteoglycan         __ carbohydrate storage in animal liver

 

  1. Polysaccharides

Pages: 244-247    

The number of structurally different polysaccharides that can be made with 20 different monosaccharides is far greater than the number of different polypeptides that can be made with 20 different amino acids, if both polymers contain an equal number (say 100) of total residues.  Explain why.

 

 

  1. Polysaccharides

Pages: 245-246    

Describe one biological advantage of storing glucose units in branched polymers (glycogen, amylopectin) rather than in linear polymers.

 

 

  1. Polysaccharides

Pages: 245-248    

Explain how it is possible that a polysaccharide molecule, such as glycogen, may have only one reducing end, and yet have many nonreducing ends.

 

  1. Polysaccharides

Pages: 245-246    

What is the biological advantage to an organism that stores its carbohydrate reserves as starch or glycogen rather than as an equivalent amount of free glucose?

 

 

  1. Polysaccharides

Page: 245 

Draw the structure of the repeating basic unit of (a) amylose and (b) cellulose.

 

  1. Polysaccharides

Pages: 246-247    

Explain in molecular terms why humans cannot use cellulose as a nutrient, but goats and cattle can.

 

 

  1. Polysaccharides

Page: 250 

The glycosaminoglycans are negatively charged at neutral pH. What components of these polymers confer the negative charge?

 

 

  1. Glycoconjugates: proteoglycans, glycoproteins, and glycolipids

Page: 253 

Sketch the principal components of a typical proteoglycan, showing their relationships and connections to one another.

 

 

 

  1. Glycoconjugates: proteoglycans, glycoproteins, and glycolipids

Pages: 252-253    

Describe the differences between a proteoglycan and a glycoprotein.

 

 

  1. Glycoconjugates: proteoglycans, glycoproteins, and glycolipids

Pages: 253-254    

Describe the structure of a proteoglycan aggregate such as is found in the extracellular matrix.

 

 

 

  1. Glycoconjugates: proteoglycans, glycoproteins, and glycolipids

Pages: 255-256    

What are some of the biochemical effects of the oligosaccharide portions of glycoproteins?

 

  1. Carbohydrates as informational molecules: the sugar code

Pages: 258-259

Describe the process by which “old” serum glycoproteins are removed from the mammalian circulatory system.

 

  1. Carbohydrates as informational molecules: the sugar code

Pages: 258-262    

What are lectins?  What are some biological processes which involve lectins?

 

Chapter 8   Nucleotides and Nucleic Acids

 

 

 

Multiple Choice Questions

 

  1. Some basics

Pages: 271-273

The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is:

 

  1. a deoxyribonucleoside.
  2. a purine nucleotide.
  3. a pyrimidine nucleotide.
  4. adenosine monophosphate.

 

  1. Some basics

Page: 273

A major component of RNA but not of DNA is:

 

 

  1. Some basics

Page: 273

The difference between a ribonucleotide and a deoxyribonucleotide is:

 

  1. a deoxyribonucleotide has an —H instead of an —OH at C-2.
  2. a deoxyribonucleotide has a configuration; ribonucleotide has the b configuration at C-1.
  3. a ribonucleotide has an extra —OH at C-4.
  4. a ribonucleotide has more structural flexibility than deoxyribonucleotide.
  5. a ribonucleotide is a pyranose, deoxyribonucleotide is a furanose.

 

  1. Some basics

Page: 273

Which one of the following is true of the pentoses found in nucleic acids?

 

  1. C-5 and C-1 of the pentose are joined to phosphate groups.
  2. C-5 of the pentose is joined to a nitrogenous base, and C-1 to a phosphate group.
  3. The bond that joins nitrogenous bases to pentoses is an O-glycosidic bond.
  4. The pentoses are always in the b-furanose forms.
  5. The straight-chain and ring forms undergo constant interconversion.

 

 

 

 

 

  1. Some basics

Pages: 274-275

The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA:

 

  1. always link A with T and G with C.
  2. are susceptible to alkaline hydrolysis.
  3. are uncharged at neutral pH.
  4. form between the planar rings of adjacent bases.
  5. join the 3 hydroxyl of one nucleotide to the 5 hydroxyl of the next.

 

  1. Some basics

Pages: 274-275

The phosphodiester bond that joins adjacent nucleotides in DNA:

 

  1. associates ionically with metal ions, polyamines, and proteins.
  2. is positively charged.
  3. is susceptible to alkaline hydrolysis.
  4. Links C-2 of one base to C-3 of the next.
  5. links C-3 of deoxyribose to N-1 of thymine or cytosine.

 

  1. Some basics

Page: 275

The alkaline hydrolysis of RNA does not produce:

 

  1. 2– AMP.
  2. 2,3-cGMP.
  3. 2-CMP.
  4. 3,5-cAMP.
  5. 3-UMP.

 

  1. Some basics

Page: 276

The DNA oligonucleotide abbreviated pATCGAC:

 

  1. has 7 phosphate groups.
  2. has a hydroxyl at its 3
  3. has a phosphate on its 3
  4. has an A at its 3
  5. violates Chargaff’s rules.

 

  1. Some basics

Page: 276

For the oligoribonucleotide pACGUAC:

 

  1. the nucleotide at the 3 end has a phosphate at its 3
  2. the nucleotide at the 3 end is a purine.
  3. the nucleotide at the 5end has a 5
  4. the nucleotide at the 5 end has a phosphate on its 5
  5. the nucleotide at the 5 end is a pyrimidine.

 

 

  1. Some basics

Page: 276

The nucleic acid bases:

 

  1. absorb ultraviolet light maximally at 280 nm.
  2. are all about the same size.
  3. are relatively hydrophilic.
  4. are roughly planar.
  5. can all stably base-pair with one another.

 

  1. Some basics

Page: 276

Which of the following statements concerning the tautomeric forms of bases such as uracil is correct?

 

  1. The all-lactim form contains a ketone group.
  2. The lactam form contains an alcohol group.
  3. The lactam form predominates at neutral pH.
  4. They are geometric isomers.
  5. They are stereoisomers.

 

  1. Some basics

Page: 277

In a double-stranded nucleic acid, cytosine typically base-pairs with:

 

 

  1. Some basics

Page: 277

In the Watson-Crick model for the DNA double helix (B form) the A–T and G–C base pairs share which one of the following properties?

 

  1. The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom.
  2. The molecular weights of the two base pairs are identical.
  3. The number of hydrogen bonds formed between the two bases of the base pair is the same.
  4. The plane of neither base pair is perpendicular to the axis of the helix.
  5. The proton-binding groups in both base pairs are in their charged or ionized form.

 

 

 

 

 

 

 

 

 

 

  1. Nucleic acid structure

Page: 278 

The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that:

 

  1. bacteria can undergo transformation.
  2. genes are composed of DNA only.
  3. mice are more susceptible to pneumonia than are humans.
  4. pneumonia can be cured by transformation.
  5. virulence is determine genetically.

 

  1. Nucleic acid structure

Page: 278

Chargaff’s rules state that in typical DNA:

 

  1. A = G.
  2. A = C.
  3. A = U.
  4. A + T = G + C.
  5. A + G = T + C.

 

  1. Nucleic acid structure

Page: 278

Based on Chargaff’s rules, which of the following are possible base compositions for double-stranded DNA?

 

%A      %G      %C      %T       %U

  1. 5          45        45        5          0
  2. 20        20        20        20        20
  3. 35        15        35        15        0
  4. all of the above
  5. none of the above

 

  1. Nucleic acid structure

Pages: 278-280

In the Watson-Crick structure of DNA, the:

 

  1. absence of 2-hydroxyl groups allows bases to lie perpendicular to the helical axis.
  2. adenine content of one strand must equal the thymine content of the same strand.
  3. nucleotides are arranged in the A-form.
  4. purine content (fraction of bases that are purines) must be the same in both strands.
  5. two strands are parallel.

 

 

  1. Nucleic acid structure

Pages: 278-280

In the Watson-Crick model of DNA structure:

 

  1. both strands run in the same direction, 3 ® 5; they are parallel.
  2. phosphate groups project toward the middle of the helix, where they are protected from interaction with water.
  3. T can form three hydrogen bonds with either G or C in the opposite strand.
  4. the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines.
  5. the distance between two adjacent bases in one strand is about 3.4 Å.

 

  1. Nucleic acid structure

Pages: 278-280

Which of the following is not true of all naturally occurring DNA?

 

  1. Deoxyribose units are connected by 3,5-phosphodiester bonds.
  2. The amount of A always equals the amount of T.
  3. The ratio A+T/G+C is constant for all natural DNAs.
  4. The two complementary strands are antiparallel.
  5. Two hydrogen bonds form between A and T.

 

  1. Nucleic acid structure

Pages: 278-280

In the Watson-Crick model of DNA structure (now called B-form DNA):

 

  1. a purine in one strand always hydrogen bonds with a purine in the other strand.
  2. A–T pairs share three hydrogen bonds.
  3. G–C pairs share two hydrogen bonds.
  4. the 5 ends of both strands are at one end of the helix.
  5. the bases occupy the interior of the helix.

 

  1. Nucleic acid structure

Pages: 278-280

The double helix of DNA in the B-form is stabilized by:

 

  1. covalent bonds between the 3 end of one strand and the 5 end of the other.
  2. hydrogen bonding between the phosphate groups of two side-by-side strands.
  3. hydrogen bonds between the riboses of each strand.
  4. nonspecific base-stacking interaction between two adjacent bases in the same strand.
  5. ribose interactions with the planar base pairs.

 

  1. Nucleic acid structure

Page: 280

In nucleotides and nucleic acids, syn and anti conformations relate to:

 

  1. base stereoisomers.
  2. rotation around the phosphodiester bond.
  3. rotation around the sugar-base bond.
  4. sugar pucker.
  5. sugar stereoisomers.

 

  1. Nucleic acid structure

Pages: 280-281

B-form DNA in vivo is a ________-handed helix, _____ Å in diameter, with a rise of ____ Å per base pair.

 

  1. left; 20; 3.9
  2. right; 18; 3.4
  3. right; 18; 3.6
  4. right; 20; 3.4
  5. right; 23; 2.6

 

  1. Nucleic acid structure

Pages: 278-280

In double-stranded DNA:

 

  1. only a right-handed helix is possible.
  2. sequences rich in A–T base pairs are denatured less readily than those rich in G–C pairs.
  3. the sequence of bases has no effect on the overall structure.
  4. the two strands are parallel.
  5. the two strands have complementary sequences.

 

  1. Nucleic acid structure

Page: 282

Which of the following is a palindromic sequence?

 

  1. AGGTCC

TCCAGG

  1. CCTTCC

GCAAGG

  1. GAATCC

CTTAGG

  1. GGATCC

CCTAGG

  1. GTATCC

CATAGG

 

  1. Nucleic acid structure

Pages: 282-283

Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions.  These interactions are primarily:

 

  1. covalent bonds involving deoxyribose.
  2. covalent bonds involving the bases.
  3. hydrogen bonds involving deoxyribose.
  4. hydrogen bonds involving the bases.
  5. hydrophobic interactions involving the bases.

 

 

  1. Nucleic acid structure

Page: 284-286

Which of the following are possible base compositions for single-stranded RNA?

 

%A      %G      %C      %T       %U

  1. 5          45        45        0          5
  2. 25        25        25        0          25
  3. 35        10        30        0          25
  4. all of the above
  5. none of the above

 

  1. Nucleic acid structure

Pages: 284-286    

Double-stranded regions of RNA:

 

  1. are less stable than double-stranded regions of DNA.
  2. can be observed in the laboratory, but probably have no biological relevance.
  3. can form between two self-complementary regions of the same single strand of RNA.
  4. do not occur.
  5. have the two strands arranged in parallel (unlike those of DNA, which are antiparallel).

 

  1. Nucleic acid chemistry

Pages: 287-288    

When double-stranded DNA is heated at neutral pH, which change does not occur?

 

  1. The absorption of ultraviolet (260 nm) light increases.
  2. The covalent N-glycosidic bond between the base and the pentose breaks.
  3. The helical structure unwinds.
  4. The hydrogen bonds between A and T break.
  5. The viscosity of the solution decreases.

 

  1. Nucleic acid chemistry

Pages: 288-289    

Which of the following deoxyoligonucleotides will hybridize with a DNA containing the sequence (5)AGACTGGTC(3)?

 

  1. (5)CTCATTGAG(3)
  2. (5)GACCAGTCT(3)
  3. (5)GAGTCAACT(3)
  4. (5)TCTGACCAG(3)
  5. (5)TCTGGATCT(3)

 

  1. Nucleic acid chemistry

Pages: 288-289    

The ribonucleotide polymer (5)GTGATCAAGC(3) could only form a double-stranded structure with:

 

  1. (5)CACTAGTTCG(3).
  2. (5)CACUAGUUCG(3).
  3. (5)CACUTTCGCCC(3).
  4. (5)GCTTGATCAC(3).
  5. (5)GCCTAGTTUG(3).

 

  1. Nucleic acid chemistry

Page: 288 

In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is:

 

  1. DNA-DNA > DNA-RNA > RNA-RNA.
  2. DNA-DNA > RNA-RNA > DNA-RNA.
  3. RNA-DNA > RNA-RNA > DNA-DNA.
  4. RNA-RNA > DNA-DNA > DNA-RNA.
  5. RNA-RNA > DNA-RNA > DNA-DNA.

 

  1. Nucleic acid chemistry

Page: 290 

In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is (are):

 

  1. low pH.
  2. UV light.
  3. both C and D.

 

  1. Nucleic acid chemistry

Page: 291 

Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by:

 

  1. breakage of phosphodiester bonds.
  2. deamination of bases.
  3. formation of thymine dimers.
  4. transformation of A ®

 

  1. Nucleic acid chemistry

Pages: 292-294    

In DNA sequencing by the Sanger (dideoxy) method:

 

  1. radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands.
  2. specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis.
  3. the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence.
  4. the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands.
  5. the template DNA strand is radioactive.

 

 

  1. Nucleic acid chemistry

Pages: 294-295                

In the chemical synthesis of DNA:

 

  1. the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond.
  2. the direction of synthesis is 5 to 3.
  3. the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides.
  4. the nucleotide initially attached to the silica gel support will become the 3 end of the finished product.
  5. the protecting cyanoethyl groups are removed after each step.

 

  1. Other functions of nucleotides

Pages: 296-298    

In living cells, nucleotides and their derivatives can serve as:

 

  1. carriers of metabolic energy.
  2. enzyme cofactors.
  3. intracellular signals.
  4. precursors for nucleic acid synthesis.
  5. all of the above.

 

  1. Other functions of nucleotides

Pages: 296-298    

The “energy carrier” ATP is an example of a(n):

 

  1. deoxyribonucleoside triphosphate
  2. di-nucleotide
  3. peptide
  4. ribonucleotide
  5. ribonucleoside triphosphate

 

 

Short Answer Questions

 

  1. Some basics

Pages: 271-272     Difficulty: 1

How are a nucleoside and a nucleotide similar and how are they different?

 

  1. Some basics

Pages: 271-277     Difficulty: 1

Match the type of bond with the role below:

 

Bond_type                                     Role

(a) phosphodiester                         ___ links base to pentose in nucleotide

(b) N-glycosidic                             ___ joins adjacent nucleotides in one strand

(c) phosphate ester                         ___ joins complementary nucleotides in two

strands

(d) hydrogen                                  ___ difference between a nucleoside and a

nucleotide

  1. Nucleic acid structure

Pages: 271-277    

Compounds that contain a nitrogenous base, a sugar, and a phosphate group are called (a)_________________.  Two purines found in DNA are (b)______________ and __________________.  A pyrimidine found in all DNA but in only some RNA is (c)_________________.  In DNA, the base pair (d)___-___ is held together by three hydrogen bonds;  the base pair (e)___-___ has only two such bonds.

 

 

  1. Nucleic acid structure

Page: 277 

Draw the structure of either an adenine-thymine or a guanine-cytosine base pair as found in the Watson-Crick double-helical structure of DNA.  Include all hydrogen bonds.

 

 

  1. Nucleic acid structure

Page: 277 

Draw the structures of hydrogen-bonded adenine and thymine.

 

  1. Nucleic acid structure

Page: 278 

Briefly describe the experimental evidence of Avery, MacLeod, and McCarty that DNA is the genetic material.

 

  1. Nucleic acid structure

Pages: 278-279    

The composition (mole fraction) of one of the strands of a double-helical DNA is [A] = 0.3, and [G] = 0.24.  Calculate the following, if possible.  If impossible, write “I.”

 

For the same strand:

[T]  =  (a)  ____

[C]  =  (b)  ____

[T] + [C]  =  (c)  ____

For the other strand:

[A]  =  (d)  ____

[T]  =  (e)  ____

[A] + [T]  =  (f)  ____

[G]  =  (g)  ____

[C]  =  (h)  ____

[G] + [C]  =  (i)  ____

 

 

  1. Nucleic acid structure

Page: 279 

What is the approximate length of a DNA molecule (in the B form) containing 10,000 base pairs?

 

 

  1. Nucleic acid structure

Page: 279 

Describe briefly what is meant by saying that two DNA strands are complementary.

 

 

  1. Nucleic acid structure

Pages: 280-281    

In one sentence, identify the most obvious structural difference between A-form (Watson-Crick) DNA and Z-form DNA.

-form DNA is a right-handed helix; Z-form DNA is a left-handed helix. (See Fig. 10-19, page 338.)

 

  1. Nucleic acid structure

Pages: 281-282    

Write a double-stranded DNA sequence containing a six-nucleotide palindrome.

 

  1. Nucleic acid structure

Pages: 284-286    

Describe briefly how noncovalent interactions contribute to the three-dimensional shapes of RNA molecules.

 

 

  1. Nucleic acid chemistry

Pages: 287-288    

Why does lowering the ionic strength of a solution of double-stranded DNA permit the DNA to denature more readily (for example, to denature at a lower temperature than at a higher ionic strength)?

 

  1. Nucleic acid chemistry

Pages: 287-288    

Describe qualitatively how the tm for a double-stranded DNA depends upon its nucleotide composition.

 

 

  1. Nucleic acid chemistry

Pages: 287-288    

A solution of DNA is heated slowly until the tm is reached.  What is the likely structure of the DNA molecules at this temperature?

 

 

  1. Nucleic acid chemistry

Pages: 288-289    

Mouse DNA hybridizes more extensively with human DNA than with yeast DNA.  Explain by describing the factor or factors that determine extent of hybridization.

 

  1. Nucleic acid chemistry

Pages: 290-291    

What is the principal effect of ultraviolet radiation on DNA?

 

 

  1. Other functions of nucleotides

Pages: 296-298    

Explain how nucleoside triphosphates (such as ATP) act as carriers of chemical energy.

 

Chapter 9   DNA-Based Information Technologies

 

 

 

Multiple Choice Questions

 

  1. DNA cloning: the basics

Pages: 304-305    

Restriction enzymes:

 

  1. act at the membrane to restrict the passage of certain molecules into the cell.
  2. are highly specialized ribonucleases that degrade mRNA soon after its synthesis.
  3. are sequence-specific DNA endonucleases.
  4. are very specific proteases that cleave peptides at only certain sequences.
  5. catalyze the addition of a certain amino acid to a specific tRNA.

 

  1. DNA cloning: the basics

Pages: 304-305    

The biological role of restriction enzymes is to:

 

  1. aid recombinant DNA research.
  2. degrade foreign DNA that enters a bacterium.
  3. make bacteria resistant to antibiotics.
  4. restrict the damage to DNA by ultraviolet light.
  5. restrict the size of DNA in certain bacteria.

  1. DNA cloning: the basics

Page: 305 

The size of the DNA region specifically recognized by type II restriction enzymes is typically:

 

  1. 4 to 6 base pairs.
  2. 10 to 15 base pairs.
  3. 50 to 60 base pairs.
  4. 200 to 300 base pairs.
  5. about the size of an average gene.

 

  1. DNA cloning: the basics

Page: 305 

Which of the following statements about type II restriction enzymes is false?

 

  1. Many make staggered (off-center) cuts within their recognition sequences.
  2. Some cut DNA to generate blunt ends.
  3. They are part of a bacterial defense system in which foreign DNA is cleaved.
  4. They cleave and ligate DNA.
  5. They cleave DNA only at recognition sequences specific to a given restriction enzyme.

 

 

 

 

 

  1. DNA cloning: the basics

Page: 305 

Certain restriction enzymes produce cohesive (sticky) ends.  This means that they:

 

  1. cut both DNA strands at the same base pair.
  2. cut in regions of high GC content, leaving ends that can form more hydrogen bonds than ends of high AT content.
  3. make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding.
  4. make ends that can anneal to cohesive ends generated by any other restriction enzyme.
  5. stick tightly to the ends of the DNA they have cut.

 

  1. DNA cloning: the basics

Page: 307             

In the laboratory, recombinant plasmids are commonly introduced into bacterial cells by:

 

  1. electrophoresis – a gentle low-voltage gradient draws the DNA into the cell.
  2. infection with a bacteriophage that carries the plasmid.
  3. mixing plasmids with an extract of broken cells.
  4. transformation – heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.

 

  1. DNA cloning: the basics
Pages: 307-308

The E. coli recombinant plasmid pBR322 has been widely utilized in genetic engineering experiments.  pBR322 has all of the following features except:

 

a number of conveniently located recognition sites for restriction enzymes.

a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradation.

a replication origin, which permits it to replicate autonomously.

resistance to two different antibiotics, which permits rapid screening for recombinant plasmids containing foreign DNA.

small overall size, which facilitates entry of the plasmid into host cells.

 

  1. DNA cloning: the basics

Pages: 307-308    

Which of the following statements regarding plasmid cloning vectors is correct?

 

Circular plasmids do not require an origin of replication to be propagated in E. coli.

Foreign DNA fragments up to 45,000 base pairs can be cloned in a typical plasmid.

Plasmids do not need to contain genes that confer resistance to antibiotics.

Plasmid vectors must carry promoters for inserted gene fragments.

The copy number of plasmids may vary from a few to several hundred.

  1. DNA cloning: the basics

Page: 307-308      

A convenient cloning vector with which to introduce foreign DNA into E. coli is a(n):

 

  1. coli chromosome.
  2. messenger RNA.
  3. yeast “ARS” sequence.
  4. yeast transposable element.

 

  1. DNA cloning: the basics

Pages: 308-309    

In genetic engineering, in vitro packaging is used to:

 

  1. cut a desired region out of the host bacterium’s chromosome.
  2. ensure that genetically engineered bacteria are not accidentally released into the environment.
  3. incorporate recombinant DNA into infectious bacteriophage particles.
  4. place an antibiotic resistance gene in a plasmid.
  5. splice a desired gene into a plasmid.

 

  1. From genes to genomes

Pages: 315-317    

Which of the following does not apply to the construction or use of a DNA library?

 

  1. Determining the location of a particular DNA sequence in a DNA library requires a suitable hybridization probe.
  2. Genomic libraries are better for expressing gene products than cDNA libraries.
  3. Many segments of DNA from a cellular genome are cloned.
  4. Specialized DNA libraries can be made by cloning DNA copies of mRNAs.
  5. The DNA copies of mRNA found in a cDNA library are made by reverse transcriptase.

 

  1. From genes to genomes

Pages: 317-318    

The PCR reaction mixture does not include:

 

  1. all four deoxynucleoside triphosphates.
  2. DNA containing the sequence to be amplified.
  3. DNA ligase.
  4. heat-stable DNA polymerase.
  5. oligonucleotide primer(s).

 

 

  1. From genes to genomes

Pages: 317-318    

Which of the following statements about the polymerase chain reaction (PCR) is false?

 

  1. DNA amplified by PCR can be cloned.
  2. DNA is amplified at many points within a cellular genome.
  3. Newly synthesized DNA must be heat-denatured before the next round of DNA synthesis begins.
  4. The boundaries of the amplified DNA segment are determined by the synthetic oligonucleotides used to prime DNA synthesis.
  5. The technique is sufficiently sensitive that DNA sequences can be amplified from a single animal or human hair.

 

  1. From genes to genomes

Page: 319 

RFLP is a:

 

  1. bacteriophage vector for cloning DNA.
  2. genetic disease.
  3. plasmid vector for cloning DNA.
  4. variation in DNA base sequence.

 

  1. From genes to genomes

Page: 323 

Current estimates indicate that humans have about ________ genes.

 

  1. 3,000
  2. 10,000
  3. 30,000
  4. 100,000
  5. 300,000

 

  1. From genes to genomes

Page: 323 

Current estimates indicate that ________ % of the human genome is translated into protein.

 

  1. less than 0.5%
  2. roughly 1.5%
  3. roughly 10%
  4. roughly 25%
  5. more than 50%

 

 

  1. From genes to genomes

Page: 323 

Rank the following organisms in order from smallest genome (number of base pairs of DNA) to largest genome.

 

  1. Human, fruit fly, coli bacterium
  2. coli bacterium, human, fruit fly
  3. coli bacterium, fruit fly, human
  4. fruit fly, coli bacterium, human
  5. fruit fly, human, coli bacterium

 

  1. From genomes to proteomes

Pages: 324-329    

Which one of the following analytical techniques does not help illuminate a gene’s cellular function?

 

  1. DNA microarray analysis
  2. Protein chip analysis
  3. Southern blotting
  4. Two-dimensional gel electrophoresis
  5. Two-hybrid analysis

 

  1. From genomes to proteomes

Page: 329 

The technique known as two hybrid analysis for detecting interacting gene products depend on:

 

  1. activation of DNA polymerase by the nearby binding of hybridizing protein complexes.
  2. direct binding of a Gal4p activation domain to a DNA sequence in the promoter region.
  3. having a promoter that responds directly to one of the two proteins whose interactions is being measured.
  4. hybridization of DNA segments corresponding to the two genes being examined.
  5. stimulation of trasncription by interaction of two Gal4p domains via fused protein sequences.

 

  1. Genome alterations and new products of biotechnology
Pages: 330-331     Difficutly: 2

A common cloning strategy for introducing foreign genes into plants with Agrobacterium employs all the following features except:

 

  1. a selectable antibiotic marker such as kanamycin resistance.
  2. a shuttle vector with 25 bp T-DNA repeats flanking the foreign gene of choice.
  3. a Ti plasmid lacking its T-DNA segment.
  4. active vir gene products from the altered Ti plasmid.
  5. an ability to induce crown gall formation in infected leaves.

 

 

 

Short Answer Questions

 

  1. DNA cloning: the basics

Pages: 306-308    

A plasmid that encodes resistance to ampicillin and tetracycline is digested with the restriction enzyme PstI, which cuts the plasmid at a single site in the ampicillin-resistance gene.  The DNA is then annealed with a PstI digest of human DNA, ligated, and used to transform E. coli cells.  (a) What antibiotic would you put in an agar plate to ensure that the cells of a bacterial colony contain the plasmid?  (b) What antibiotic-resistance phenotypes will be found on the plate?  (c) Which phenotype will indicate the presence of plasmids that contain human DNA fragments?

 

 

  1. DNA cloning: the basics

Pages: 306-308                

Explain how each of the following is used in cloning in a plasmid:  (a) antibiotic resistance genes; (b) origin of replication; (c) polylinker region.

 

  1. DNA cloning: the basics

Page: 307 

Match each feature of the plasmid pBR322 (at left) with one appropriate description presented (at right) (see illustration of pBR322 below).  Descriptions may be used more than once.

____ ampR sequence    (a) permits selection of bacteria containing the plasmid

____ ori sequence         (b) a sequence required for packaging recombinant plasmids

____ tetR                           into bacteriophage

____ BamHI sequence  (c) origin of replication

____ PstI sequence       (d) cleavage of the plasmid here does not affect antibiotic

sequence resistance genes

(e) insertion of foreign DNA here permits identification of

bacteria containing recombinant plasmids

 

  1. DNA cloning: the basics

Pages: 306-308    

Explain briefly the properties of the plasmid pBR322 that make it so convenient as a vector for cloning fragments of foreign DNA.

 

 

  1. DNA cloning: the basics

Pages: 308-309    

When bacteriophage l is used as a cloning vector, what limits the size of the DNA fragment that can be cloned?

 

.

 

  1. DNA cloning: the basics

Pages: 309-310    

How does a Bacterial Artificial Chromosome (BAC) differ from a plasmid?

 

 

 

  1. DNA cloning: the basics

Page: 310 

What is(are) the distinguishing feature(s) of a shuttle vector?

 

 

  1. DNA cloning: the basics

Pages: 311           

Explain why a probe designed to detect a gene encoding a particular amino acid sequence must usually consist of a mixture of different DNA sequences rather than only one sequence.

 

 

  1. DNA cloning: the basics

Page: 312 

What sequences are required in an expression vector (for use with E. coli) that are not essential in a cloning plasmid?

 

 

  1. DNA cloning: the basics

Page: 312 

A scientist wishes to produce a mammalian protein in E. coli.  The protein is a glycoprotein with a molecular weight of 40,000.  Approximately 20% of its mass is polysaccharide.  The isolated protein is usually phosphorylated and contains three disulfide bonds.  The cloned gene contains no introns.  (a) What sequences or sites will be required in the vector to get this gene regulated, transcribed, and translated in E. coli?  (b) List two problems that might arise in producing a protein identical to that isolated from mammalian cells and describe each problem in no more than two sentences.

 

  1. From genes to genomes

Pages: 315-316    

What is the essential difference between a genomic library and a cDNA library?

 

 

  1. From genes to genomes

Pages: 315-316    

Name one enzyme that is always used to make a cDNA library, but is generally not used to make a genomic DNA library.  Describe its function briefly.

 

  1. From genes to genomes

Pages: 317-318    

A DNA sequence that may be present as only a single copy in a large mammalian genome can be amplified and cloned using the polymerase chain reaction (PCR).  Describe the steps and reaction components required in a PCR experiment.  Illustrate the steps in just one round.

 

  1. From genes to genomes

Pages: 317-318     Difficulty: 1

Why must the DNA polymerase used in the polymerase chain reaction (PCR) be heat stable?

 

 

  1. From genes to genomes

Page: 319 

What are RFLPs and how are they used in forensic DNA fingerprinting technology?

 

  1. From genes to genomes

Page: 323 

Which would you expect to be larger, the % of the human genome that is translated into protein, or the % of the genome of a bacterium that is translated into protein? Why?

 

 

  1. From genomes to proteomes
Page: 324

Distinguish between protein function at the molecular, cellular, and phenotypic level.

 

 

  1. From genomes to proteomes

Pages: 325-328    

What is a DNA microarray?  How does it resemble and how does it differ from a DNA library?

 

 

 

  1. Genome alterations and new products of biotechnology

Pages: 330-332    

Match the molecules, plasmids, or genes involved in plant cell transformation by Agrobacteria (at left) with one appropriate description from the list (at right) – letters may be used more than once.

____  vir             (a) segment of the Ti plasmid transferred to the plant cell genome

____  cytokinin  (b) genes that encode proteins required for transfer of a segment of

____  opine              the Ti plasmid to the plant cell genome

____  T DNA      (c) a plant growth hormone

(d) an unusual metabolite that can be metabolized only by

Agrobacteria

(e) encodes enzymes required to metabolize auxin

 

  1. Genome alterations and new products of biotechnology

Pages: 330-331    

Much time and money are currently being spent trying to genetically alter plants.  Why?  What benefits for humankind might be realized by altering the genetic material of plants?

 

  1. Genome alterations and new products of biotechnology

Page: 334 

Briefly describe how a transgenic animal is produced.

 

 

  1. Genome alterations and new products of biotechnology

Pages: 335-336    

Suppose a biochemist has just developed a technique for the efficient replacement of mutant genes with normal ones in human germ line cells.  She proposes to use this technology to eliminate familial hypercholesterolemia from the human gene pool.  Similar projects are being proposed in several other countries.  Should the U.S. National Institutes of Health allow her to proceed?  Why or why not?  This question has no correct answer.  Thoughtful responses should be defended in four sentences or less.

 

Chapter 10   Lipids

 

 

 

Multiple Choice Questions

 

  1. Structural lipids in membranes

Pages: 343-345    

Which of the following statements concerning fatty acids is correct?

 

  1. One is the precursor of prostaglandins.
  2. Phosphatidic acid is a common one.
  3. They all contain one or more double bonds.
  4. They are a constituent of sterols.
  5. They are strongly hydrophilic.

 

  1. Storage Lipids

Pages: 346-358    

Which of the following molecules or substances contain, or are derived from, fatty acids?

 

  1. Beeswax
  2. Prostaglandins
  3. Sphingolipids
  4. Triacylglycerols
  5. All of the above contain or are derived from fatty acids.

 

  1. Storage Lipids

Pages: 349           

Biological waxes are all:

 

  1. trimesters of glycerol and palmitic acid.
  2. esters of single fatty acids with long-chain alcohols.
  3. trimesters of glycerol and three long chain saturated fatty acids.
  4. none of the above.

 

  1. Storage Lipids

Pages: 346-358    

Which of the following statements is true of lipids?

 

  1. Many contain fatty acids in ester or amide linkage.
  2. Most are simply polymers of isoprene.
  3. Testosterone is an important sphingolipid found in myelin.
  4. They are more soluble in water than in chloroform.
  5. They play only passive roles as energy-storage molecules.

 

  1. Structural lipids in membranes

Pages: 351-352    

Which of the following contains an ether-linked alkyl group?

 

  1. Cerebrosides
  2. Gangliosides
  3. Phosphatidyl serine
  4. Platelet-activating factor
  5. Sphingomyelin

 

  1. Structural lipids in membranes

Pages: 352-353    

Sphingosine is not a component of:

 

 

  1. Structural lipids in membranes

Page: 352 

Which of the following statements about membrane lipids is true?

 

  1. Glycerophospholipids are found only in the membranes of plant cells.
  2. Glycerophospholipids contain fatty acids linked to glycerol through amide bonds.
  3. Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid.
  4. Some sphingolipids include oligosaccharides in their structure.
  5. Triacylglycerols are the principal components of erythrocyte membranes.

 

  1. Structural lipids in membranes

Page: 352 

Which of the following is true of sphingolipids?

 

  1. Cerebrosides and gangliosides are sphingolipids.
  2. Phosphatidylcholine is a typical sphingolipid.
  3. They always contain glycerol and fatty acids.
  4. They contain two esterified fatty acids.
  5. They may be charged, but are never amphipathic.

 

  1. Structural lipids in membranes

Pages: 352-354    

A compound containing N-acetylneuraminic acid (sialic acid) is:

 

  1. ganglioside GM2.
  2. platelet-activating factor.

 

  1. Lipids as signals, cofactors, and pigments

Pages: 352-363    

Fatty acids are a component of:

 

  1. vitamin D.
  2. vitamin K.

 

  1. Structural lipids in membranes

Pages: 355-356    

Which of the following statements about sterols is true?

 

  1. All sterols share a fused-ring structure with four rings.
  2. Sterols are found in the membranes of all living cells.
  3. Sterols are soluble in water, but less so in organic solvents such as chloroform.
  4. Stigmasterol is the principal sterol in fungi.
  5. The principal sterol of animal cells is ergosterol.

 

  1. Structural lipids in membranes

Pages: 355-356    

Which of the following is not true of sterols?

 

  1. Cholesterol is a sterol that is commonly found in mammals.
  2. They are commonly found in bacterial membranes.
  3. They are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.).
  4. They are precursors of steroid hormones.
  5. They have a structure that includes four fused rings.

 

  1. Structural lipids in membranes

Page: 355 

Which of the following best describes the cholesterol molecule?

 

  1. Amphipathic
  2. Nonpolar, charged
  3. Nonpolar, uncharged
  4. Polar, charged
  5. Polar, uncharged

 

  1. Structural lipids in membranes

Page: 356 

Tay-Sachs disease is the result of a genetic defect in the metabolism of:

 

  1. phosphatidyl ethanolamine.
  2. vitamin D.

 

  1. Storage Lipids

Pages: 357-361    

An example of a glycerophospholipid that is involved in cell signaling is:

 

  1. arachidonic acid.
  2. vitamin A (retinol).

 

  1. Lipids as signals, cofactors, and pigments

Pages: 358           

Non-steroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of:

 

  1. biological waxes
  2. prostaglandins
  3. sphingolipids
  4. vitamin D
  5. none of the above

 

  1. Lipids as signals, cofactors, and pigments

Pages: 360-363    

Which of the following is not a fat-soluble vitamin?

 

  1. A
  2. C
  3. D
  4. E
  5. K

 

  1. Lipids as signals, cofactors, and pigments

Pages: 360-363    

Which vitamin is derived from cholesterol?

 

  1. A
  2. B12
  3. D
  4. E
  5. K

 

  1. Lipids as signals, cofactors, and pigments

Page: 361 

Identify the molecule(s) derived from sterols.

 

  1. Arachidonic acid
  2. Gangliosides
  3. Phosphatidylglycerol
  4. Prostaglandins
  5. Vitamin D

 

 

Short Answer Questions

 

  1. Storage lipids

Pages: 344-345     Difficulty: 1

Circle the fatty acid in each pair that has the higher melting temperature.

(a)  18:1D9  18:2D9,12

(b)  18:0      18:1D9

(c)  18:0      16:0

 

 

  1. Storage lipids

Pages: 344-345    

Describe the dependence of the melting point of a fatty acid upon (a) chain length and (b) unsaturation; (c) explain these dependencies in molecular terms.

 

 

  1. Storage lipids

Page: 345  Difficulty: 1

What is the effect of a double bond on fatty acid structure?

 

 

  1. Storage lipids

Pages: 345-346    

In cells, fatty acids are stored as triacylglycerols for energy reserves.  (a) What is the molecule to which fatty acids are esterified to form triacylglycerols?  (b) Define the logic behind cells storing fatty acids in esterified form.

 

  1. Storage lipids

Pages: 345-350    

What is the most significant chemical difference between triacylglycerols and glycerophospholipids that leads to their different functions?

 

 

  1. Storage lipids

Pages: 346-347    

Describe three functions of triacylglycerols in mammals and one function in higher plants.

 

 

  1. Structural lipids in membranes

Page: 348 

What are the chemical components of a biological wax, and what is their general structure?

 

 

 

  1. Structural lipids in membranes

Page: 351 

Draw the structure of phosphatidylserine in the ionic form it would have at pH 7.

 

 

  1. Structural lipids in membranes

Page: 351 

Give the structure of phosphatidylethanolamine containing one palmitate and one oleate.  Show the ionic form expected at pH 7. How many ester bonds are there in this compound?

 

  1. Structural lipids in membranes

Page: 351 

Draw the structure of phosphatidylcholine.  Circle the part of the molecule that is polar and draw an arrow to the part that is nonpolar.

 

 

  1. Structural lipids in membranes

Page: 351 

Show the basic structure of all glycerophospholipids.

 

 

  1. Structural lipids in membranes

Page: 351 

What chemical features distinguish a plasmalogen from a common glycerophospholipid?

 

 

  1. Structural lipids in membranes

Page: 353 

Show the structure of sphingosine and indicate the relationship between sphingosine and ceramide.

 

 

  1. Structural lipids in membranes

Page: 353 

What chemical features distinguish a cerebroside from a ganglioside?

 

  1. Lipids as signals, cofactors, and pigments

Pages: 353-361    

Match the compounds on the left with the important roles they play listed on the right.  (Answers are used only once.)

(a)    prostaglandins  ___ blood clotting

(b)    sphingolipids    ___ necessary for sight

(c)    thromboxanes   ___ mediates pain and inflammation

(d)    vitamin A         ___ important component of myelin membranes

 

  1. Lipids as signals, cofactors, and pigments

Pages: 355           

Describe the differences between the glycosphingolipids corresponding to the A, B and O human blood group antigens.

 

 

  1. Structural lipids in membranes

Page: 356 

Explain the cause of hereditary diseases of sphingolipid metabolism, such as Tay-Sachs and Niemann-Pick diseases.

 

  1. Lipids as signals, cofactors, and pigments

Pages: 360-363    

Match each of these vitamins with its biological role: Vitamins A, D, E, K.

____ blood clotting

____ vision

____ Ca2+ and phosphate metabolism

____ prevention of oxidative damage

 

 

  1. Lipids as signals, cofactors, and pigments

Pages: 359-361    

Show the structure of isoprene; explain what is meant by isoprenoid compounds and give an example.

 

  1. Lipids as signals, cofactors, and pigments

Pages: 361-362    

What do all these compounds have in common: vitamin A, vitamin K, ubiquinone, and dolichol?

 

 

  1. Working with Lipids

Pages: 363-364    

Explain why extraction of lipids from tissues requires organic solvents.

 

 

  1. Working with Lipids

Pages: 364-365    

If beeswax, cholesterol, and phosphatidylglycerol were dissolved in chloroform, then subjected to thin-layer chromatography on silica gel using a mixture of chloroform/methanol/water as the developing solvent, which would move fastest?

 

Chapter 11   Biological Membranes and Transport

 

 

 

Multiple Choice Questions

 

  1. The composition and architecture of membranes

Page: 372             

Which one of the following statements about membranes is true?

 

  1. Most plasma membranes contain more than 70% proteins.
  2. Sterol lipids are common in bacterial plasma membranes.
  3. Sterol lipids are common in human cell plasma membranes.
  4. Sterol lipids are common in plant cell plasma membranes.
  5. The plasma membranes of all cell types within a particular organism have basically the same lipid and protein composition.

 

  1. The composition and architecture of membranes

Page: 372             

The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight.  How many molecules of membrane lipid are there for each molecule of protein?  (Assume that the average protein is Mr 50,000 and the average lipid is 750.)

 

  1. 1
  2. 50
  3. 200
  4. 10,000
  5. 50,000

 

  1. The composition and architecture of membranes

Page: 372             

Which of these statements about the composition of biological membranes is false?

 

  1. In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins.
  2. The carbohydrate found in membranes is virtually all part of either glycolipids or glycoproteins.
  3. The plasma membranes of the cells of vertebrate animals contain more cholesterol than the mitochondrial membranes.
  4. The ratio of lipid to protein varies widely among cell types in a single organism.
  5. Triacylglycerols are not commonly found in membranes

 

  1. The composition and architecture of membranes

Page: 372             

Which of these statements about the composition of membranes is true?

 

  1. All biological membranes contain cholesterol.
  2. Free fatty acids are major components of all membranes.
  3. The inner and outer membranes of mitochondria have different protein compositions.
  4. The lipid composition of all membranes of eukaryotic cells is essentially the same.
  5. The lipid:protein ratio varies from about 1:4 to 4:1
  6. The composition and architecture of membranes

Pages: 375-377                

Membrane proteins:

 

  1. are sometimes covalently attached to lipid moieties.
  2. are sometimes covalently attached to carbohydrate moieties.
  3. are composed of the same 20 amino acids found in soluble proteins.
  4. diffuse laterally in the membrane unless they are anchored
  5. have all of the properties listed above.

 

  1. The composition and architecture of membranes

Page: 375

Peripheral membrane proteins:

 

  1. are generally noncovalently bound to membrane lipids.
  2. are usually denatured when released from membranes.
  3. can be released from membranes only by treatment with detergent(s).
  4. may have functional units on both sides of the membrane.
  5. penetrate deeply into the lipid bilayer.

 

  1. The composition and architecture of membranes

Page: 375

An integral membrane protein can be extracted with:

 

  1. a buffer of alkaline or acid pH.
  2. a chelating agent that removes divalent cations.
  3. a solution containing detergent.
  4. a solution of high ionic strength.
  5. hot water.

 

  1. The composition and architecture of membranes

Page: 378

The shortest a helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues.

 

  1. 5
  2. 20
  3. 50
  4. 100
  5. 200

 

  1. The composition and architecture of membranes

Page: 378

A hydropathy plot is used to:

 

  1. determine the water-solubility of a protein.
  2. deduce the quaternary structure of a membrane protein.
  3. determine the water content of a native protein.
  4. extrapolate for the true molecular weight of a membrane protein.
  5. predict whether a given protein sequence contains membrane-spanning segments.

 

  1. The composition and architecture of membranes

Page: 378

Which of these statements is generally true of integral membrane proteins?

 

  1. A hydropathy plot reveals one or more regions with a high hydropathy index.
  2. The domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides.
  3. They are unusually susceptible to degradation by trypsin.
  4. They can be removed from the membrane with high salt or mild denaturing agents.
  5. They undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer.

 

  1. Membrane dynamics

Page: 382

Which of these is a general feature of the lipid bilayer in all biological membranes?

 

  1. Individual lipid molecules are free to diffuse laterally in the surface of the bilayer.
  2. Individual lipid molecules in one face (monolayer) of the bilayer readily diffuse (flip-flop) to the other monolayer.
  3. Polar, but uncharged, compounds readily diffuse across the bilayer.
  4. The bilayer is stabilized by covalent bonds between neighboring phospholipid molecules.
  5. The polar head groups face inward toward the inside of the bilayer.

 

  1. Membrane dynamics

Page: 382

The type of motion least common in biological membranes is:

 

  1. flip-flop diffusion of phospholipid from one monolayer to the other.
  2. lateral diffusion of individual lipid molecules within the plane of each monolayer.
  3. lateral diffusion of membrane proteins in the bilayer.
  4. lateral diffusion of protein molecules in the lipid bilayer
  5. random motion of the fatty acyl side chains in the interior of the phospholipid bilayer.

 

  1. Membrane dynamics

Page: 381

The fluidity of the lipid side chains in the interior of a bilayer is generally increased by:

 

  1. a decrease in temperature.
  2. an increase in fatty acyl chain length.
  3. an increase in the number of double bonds in fatty acids.
  4. an increase in the percentage of phosphatidyl ethanolamine
  5. the binding of water to the fatty acyl side chains.

 

 

 

 

 

 

 

 

 

  1. Membrane dynamics

Page: 381

The fluidity of a lipid bilayer will be increased by:

 

  1. decreasing the number of unsaturated fatty acids.
  2. decreasing the temperature.
  3. increasing the length of the alkyl chains.
  4. increasing the temperature.
  5. substituting 18:0 (stearic acid) in place of 18:2 (linoleic acid).

 

  1. Membrane dynamics

Page: 382

When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by:

 

  1. increasing its metabolic rate to generate more heat.
  2. putting longer-chain fatty acids into its membranes.
  3. putting more unsaturated fatty acids into its membranes.
  4. shifting from aerobic to anaerobic metabolism.
  5. synthesizing thicker membranes to insulate the cell.

 

  1. Membrane dynamics

Page: 388

Membrane fusion leading to neurotransmitter release requires the action of:

 

  1. tSNARE and vSNARE.
  2. none of the above.

 

  1. Membrane dynamics

Page: 388

Integrins are:

 

  1. membrane proteins that are involved in ion transport.
  2. membrane proteins that are involved in sugar transport.
  3. membrane proteins that mediate cell adhesion.
  4. proteins of the extracellular matrix that bind to cell surface proteins.
  5. proteins that are found at the membrane-cytoplasm interface.

 

  1. Membrane dynamics

Pages: 387, 391

A process not involving the fusion of two membranes or two regions of the same membrane is:

 

  1. entry of enveloped viruses into cells.
  2. entry of glucose into cells.
  3. reproductive budding in yeast

 

  1. Membrane dynamics

Page: 387

According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion?

 

  1. A cell surface co-receptor protein
  2. A cell surface receptor protein
  3. A viral glycoprotein complex
  4. The viral chromosome
  5. The viral envelope

 

  1. Solute transport across membranes

Page: 391

Which of these statements about facilitated diffusion across a membrane is true?

 

  1. A specific membrane protein lowers the activation energy for movement of the solute through the membrane.
  2. It can increase the size of a transmembrane concentration gradient of the diffusing solute.
  3. It is impeded by the solubility of the transported solute in the nonpolar interior of the lipid bilayer.
  4. It is responsible for the transport of gases such as O2, N2, and CH4 across biological membranes.
  5. The rate is not saturable by the transported substrate

 

  1. Solute transport across membranes

Page: 390

Facilitated diffusion through a biological membrane is:

 

  1. driven by a difference of solute concentration.
  2. driven by ATP.
  3. generally irreversible.
  4. not specific with respect to the substrate

 

  1. Solute transport across membranes

Pages: 391-392

Glucose transport into erythrocytes is an example of:

 

  1. active transport.
  2. electrogenic uniport
  3. facilitated diffusion.

 

 

  1. Solute transport across membranes

Pages: 391-393

For the process of solute transport, the constant Kt is:

 

  1. analogous to Kafor ionization of a weak acid.
  2. analogous to Kmfor an enzyme-catalyzed reaction.
  3. analogous to Vmax for an enzyme reaction
  4. proportional to the number of molecules of glucose transporter per cell.
  5. the maximum rate of glucose transport.

 

  1. Solute transport across membranes

Pages: 395-396

The type of membrane transport that uses ion gradients as the energy source is:

 

  1. facilitated diffusion
  2. passive transport.
  3. primary active transport.
  4. secondary active transport.
  5. simple diffusion.

 

  1. Solute transport across membranes

Page: 396

Consider the transport of glucose into an erythrocyte by facilitated diffusion.  When the glucose concentrations are 5 mM on the outside and 0.1 mM on the inside, the free-energy change for glucose uptake into the cell is:  (These values may be of use to you:  R = 8.315 J/mol·K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 ´ 1023/mol.)

 

  1. less than 2 kJ/mol.
  2. about 10 kJ/mol.
  3. about 30 kJ/mol.
  4. about –30 kJoule/mol.
  5. impossible to calculate without knowledge of the membrane potential.

 

  1. Solute transport across membranes

Page: 396

Consider the transport of K+ from the blood (where its concentration is about 4 mM) into an erythrocyte that contains 150 mM K+.  The transmembrane potential is about 60 mV, inside negative relative to outside.  The free-energy change for this transport process is:  (These values may be of use to you:  R = 8.315 J/mol.K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 ´ 1023/mol.)

 

  1. about 5 J/mol.
  2. about 15 J/mol.
  3. about 5 kJ/mol.
  4. about 15 kJ/mol.
  5. impossible to calculate with the information given.

 

 

 

 

  1. Solute transport across membranes

Pages: 397-398

An electrogenic Na+ transporter:

 

  1. catalyzes facilitated diffusion of Na+from a region of high Na+ concentration to one of lower Na+
  2. must catalyze an electron transfer (oxidation-reduction) reaction simultaneously with Na+
  3. must transport both Na+and a counterion (Cl, for example).
  4. transports Na+against its concentration gradient.
  5. transports Na+ without concurrent transport of any other charged species.

 

  1. Solute transport across membranes

Page: 398

In one catalytic cycle, the Na+/K+ ATPase transporter transports:

 

  1. 2 Na+ out, 3 K+ in, and converts 1 ATP to ADP + Pi.
  2. 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi.
  3. 3 Na+ in, 2 K+ out, and converts 1 ATP to ADP + Pi.
  4. 1 Na+ out, 1 K+ in, and converts 1 ATP to ADP + Pi.
  5. 2 Na+ out, 3 K+ in, and converts 1 ADP + Pi to ATP.

 

  1. Solute transport across membranes

Pages: 404-405

Movement of water across membranes is facilitated by proteins called:

 

 

  1. Solute transport across membranes

Pages: 407-408

The specificity of the potassium channel for K+ over Na+ is mainly the result of the:

 

  1. differential interaction with the selectivity filter protein.
  2. hydrophobicity of the channel.
  3. phospholipid composition of the channel.
  4. presence of carbohydrates in the channel.
  5. presence of cholesterol in the channel.

 

 

  1. Solute transport across membranes

Page: 410

A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is:

 

  1. a charged lipid in the membrane bilayer that allows ions to pass through.
  2. a membrane protein that permits a ligand to pass through the membrane only when opened by the appropriate ion.
  3. a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand.
  4. a molecule that binds to the membrane thereby allowing ions to pass through.
  5. always requires a second ligand to close the channel once it is opened.

 

 

 

Short Answer Questions

 

  1. The composition and architecture of membranes

Page: 372 

The plasma membrane of an animal cell consists of 45% by weight of phospholipid and 55% protein.  What is the mole ratio (moles of lipid/moles of protein) if the average molecular weight of phospholipids is 750 and the average molecular weight of membrane proteins is 50,000?

 

 

  1. The composition and architecture of membranes

Page: 372 

(a) List the major components of membranes.  (b) When a preparation of mitochondrial membranes was treated with high salt (0.5 M NaCl), it was observed that 40% of the total protein in this preparation was solubilized.  What kind of membrane proteins are in this soluble extract, and what forces normally hold them to the membrane? (c) What kind of proteins constitute the insoluble 60%, and what forces hold these proteins in the membrane?

 

  1. The composition and architecture of membranes

Page: 373 

What are the principle features of the fluid mosaic model of membranes?

 

 

  1. The composition and architecture of membranes

Page: 373 

Draw the structure of a biological membrane as proposed by the fluid mosaic model.  Indicate the positions and orientations of phospholipids, cholesterol, integral and peripheral membrane proteins, and the carbohydrate moieties of glycoproteins and glycolipids.

 

 

  1. The composition and architecture of membranes

Page: 374 

What is an amphipathic compound?  Explain how such compounds contribute to the structure of biological membranes.

 

 

  1. The composition and architecture of membranes

Page: 374 

(a) When relatively high concentrations of fatty acids are suspended in water, they form structures known as ________.  (b) When relatively high concentrations of membrane phospholipids are dissolved in water, they form structures known as ________.  (c) Why are the structures listed in your answers to (a) and (b) above energetically favored?

 

  1. The composition and architecture of membranes

Page: 374 

(a) Define the term amphipathic.  (b) Diagram two types of assemblies that amphipathic molecules form in water.  (c) What are the forces that contribute to the formation of the structures diagrammed in (b)?

 

 

  1. The composition and architecture of membranes

Page: 374 

(a) Explain why phosphoglycerides are capable of spontaneously assembling into the bilayer structure found in biological membranes but triacylglycerols are not.  (b) What are the forces that drive bilayer formation?

 

 

  1. The composition and architecture of membranes

Pages: 375-377    

You are presented with a gram of a newly isolated animal virus.  Electron microscopy reveals the presence of a typical membrane surrounding the virus, and chemical analysis shows the presence of two membrane lipids, phosphatidylethanolamine and phosphatidylserine, as well as several membrane-associated proteins.  Describe briefly a simple experimental approach to answering each of the following questions:  (a) Which proteins are exposed at the outer surface and which traverse the membrane, with parts of their structure in the cytoplasm and parts outside the cell?  (b) Are the phosphatidylethanolamine and phosphatidylserine symmetrically disposed in the two faces of the bilayer?

 

 

  1. The composition and architecture of membranes

Pages: 375-377    

Reagents A and B both react covalently with primary amino groups such as those of phosphatidylethanolamine.  Reagent A permeates erythrocytes, but reagent B is impermeant.  Both A and B are available in radioisotopically labeled form.  Describe a simple experiment by which you might determine whether the phosphatidylethanolamine of erythrocyte membranes is located in the outside face of the lipid bilayer, the inside face, or in both.  Be brief and use diagrams to support your answer.

 

  1. The composition and architecture of membranes

Pages: 375-377    

Explain the differences between integral and peripheral membrane proteins.

 

  1. The composition and architecture of membranes

Pages: 375-377    

(a) What kinds of forces or bonds anchor an integral membrane protein in a biological membrane?  (b) What forces hold a peripheral membrane protein to the membrane?  (c) What might one do to solubilize each of the two types of membrane proteins?

 

  1. The composition and architecture of membranes

Page: 378 

A protein is found to extend all the way through the membrane of a cell.  Describe this protein in terms of the location of particular types of amino acid side chains in its structure and its ability to move within the membrane.

 

 

  1. The composition and architecture of membranes

Page: 378 

If the hydrophobic interior of a membrane were about 3 nm thick, what would be the minimum number of amino acids in a stretch of transmembrane a helix?

 

 

  1. Membrane dynamics

Page: 378 

The pitch of an alpha helix is 5.4 A per turn, and there are 3.6 amino acid residues per turn.  If the thickness of the lipid bilayer is 30 A, how many amino acid residues are required in an alpha helix that is just long enough to span the lipid bilayer?

 

 

  1. The composition and architecture of membranes

Page: 378 

Draw a hydropathy plot for a hypothetical integral membrane protein with 3 transmembrane segments and containing 190 amino acids.  Be sure to label the x- and y-axes appropriately, including numerical values.

 

  1. The composition and architecture of membranes

Page: 378 

What is a hydropathy plot?  Sketch if you like, but label the axes.

 

 

  1. The composition and architecture of membranes

Page: 378 

Why is a hydropathy plot useful, and what are its limitations?

 

 

  1. Membrane dynamics

Page: 382 

The bacterium E. coli can grow at 20 °C or at 40 °C.  At which growth temperature would you expect the membrane phospholipids to have a higher ratio of saturated to unsaturated fatty acids, and why?

 

 

  1. Membrane dynamics

Pages: 381-382    

Describe two ways a plant can adjust the components of its cell membranes to keep them as fluid as possible on a cold winter morning.

 

  1. Membrane dynamics

Pages: 381-382    

A plant breeder has developed a new frost-resistant variety of tomato that contains higher levels of unsaturated fatty acids in membrane lipids than those found in standard tomato varieties. However, when temperatures climb above 95 °F, this frost-resistant variety dies, whereas the standard variety continues to grow.  Provide a likely explanation of the biochemical basis of increased tolerance to cold and increased susceptibility to heat of this new tomato variety.

 

  1. Membrane dynamics

Pages: 381-382    

  1. a) What is meant by the transition temperature of a membrane? List the two characteristics of the fatty acids in a biological membrane that affect the transition temperature.  Using ­ or ¯,  show in which direction an increase in these characteristics would change the  transition temperature.

 

 

  1. Membrane dynamics

Pages: 384-386    

Glycosphingolipids and cholesterol cluster together in membrane regions known as “__________”.  These microdomains are more __________ than the surrounding phospholipid-rich membrane due to a high content of __________ fatty acids.  These regions are rich in proteins that are anchored to the membrane by covalently attached __________ and __________ groups and also those anchored by GPI linkage.  Proteins aggregated in this fashion are often functionally related.  Examples are (1) __________ proteins and (2) __________ proteins.

 

 

  1. Membrane dynamics

Page: 388 

What are the similarities and differences between integrins, cadherins, and selectins?

 

 

  1. Solute transport across membranes

Pages: 389-391    

Distinguish between simple diffusion (SD), facilitated diffusion (FD), and active transport (AT) across a membrane for the following questions (more than one may be true).

 

(a) Which processes are energy dependent?

(b) Which processes need some kind of carrier protein(s)?

(c) Which processes can be saturated by substrate?

(d) Which processes can establish a concentration gradient?

(e) How much energy does it take to transport an uncharged substrate in, if its starting inside concentration is 10-fold greater than outside?

 

  1. Solute transport across membranes

Page: 389 

Explain why nonpolar compounds are generally able to diffuse across biological membranes without the aid of a specific transport system.

 

 

  1. Solute transport across membranes

Page: 389 

Phospholipids are amphipathic molecules.  Show how this property accounts for the impermeability of biological membranes to polar compounds and ions.

 

 

  1. Solute transport across membranes

Pages: 391-393    

Compare the structure and activity of a membrane transport protein that transports a polar substance across a membrane with a typical soluble enzyme.  How are transporter and enzyme similar?  How are they different?

 

 

  1. Solute transport across membranes

Pages: 395-398    

Compare and contrast symport and antiport.  Which term best describes the transport system mediated by the Na+K+ ATPase?

 

 

 

 

  1. Solute transport across membranes

Pages: 396-398, 406-409 

What are three differences between ion channels and ion transporters?

 

.

 

  1. Solute transport across membranes

Pages: 406-410    

What is the major difference between gated and non-gated ion channels? Give an example of two different gating signals.

 

 

 

Chapter 12   Biosignaling

 

 

 

Multiple Choice Questions

 

  1. Molecular mechanisms of signal transduction

Page: 420

 

Which of the following is not involved in the specificity of signal transduction?

 

  1. Interactions between receptor and signal molecules
  2. Location of receptor molecules
  3. Structure of receptor molecules
  4. Structure of signal molecules
  5. Transmembrane transport of signal molecules by receptor molecules

 

  1. Molecular mechanisms of signal transduction

Page: 421

Scatchard analysis can provide information on:

 

  1. enzyme cascades.
  2. enzyme mechanisms.
  3. gated ion channels.
  4. protein phosphorylation.
  5. receptor-ligand interactions.

 

  1. General Features of Signal Transduction

Page: 422

Which of the following statements concerning receptor enzymes is correct?

 

  1. They are not usually membrane-associated proteins.
  2. They contain an enzyme activity that acts upon a cytosolic substrate.
  3. They contain an enzyme activity that acts upon the extracellular ligand.
  4. They have a ligand-binding site on the cytosolic side of the membrane.
  5. They have an active site on the extracellular side of the membrane.

 

  1. General Features of Signal Transduction

Page: 422

Guanyl cyclase receptor enzymes:

 

  1. are all membrane-spanning proteins.
  2. are examples of ligand-gated ion channels.
  3. catalyze synthesis of a phosphate ester.
  4. catalyze synthesis of a phosphoric acid anhydride.
  5. require hydrolysis of ATP in addition to GTP.

 

 

 

 

  1. G protein-coupled receptors and second messengers

Page: 424

Serpentine receptors:

 

  1. are examples of G (GTP-binding) regulatory proteins.
  2. are mainly involved in the regulation of ion transport.
  3. are present in prokaryotic cells but not in eukaryotic cells.
  4. are present in the nucleus and affect gene expression.
  5. have multiple membrane-spanning helical domains.

 

  1. G protein-coupled receptors and second messengers

Pages: 426-427

Cholera and pertussis toxins are:

 

  1. enzyme inhibitors.
  2. enzyme modifiers.
  3. G protein signal transduction disrupters.
  4. all of the above.

 

  1. G protein-coupled receptors and second messengers

Page: 428

Protein kinase A (PKA) is:

 

  1. activated by covalent binding of cyclic AMP.
  2. affected by cyclic AMP only under unusual circumstances.
  3. allosterically activated by cyclic AMP.
  4. competitively inhibited by cyclic AMP.
  5. noncompetitively inhibited by cyclic AMP.

 

  1. G protein-coupled receptors and second messengers

Page: 429

Which of the following is not involved in signal transduction by the b-adrenergic receptor pathway?

 

  1. ATP
  2. Cyclic AMP
  3. Cyclic GMP
  4. GTP
  5. All of the above are involved.

 

  1. G protein-coupled receptors and second messengers

Page: 429

Which of the following is not involved in signal transduction by the b-adrenergic receptor pathway?

 

  1. Cyclic AMP synthesis
  2. GTP hydrolysis
  3. GTP-binding protein
  4. Protein kinase
  5. All of the above are involved.

 

 

  1. G protein-coupled receptors and second messengers

Page: 431

Which of the following does not involve cyclic AMP?

 

  1. Regulation of glycogen synthesis and breakdown
  2. Regulation of glycolysis
  3. Signaling by acetylcholine
  4. Signaling by epinephrine
  5. Signaling by glucagon

 

  1. G Protein-coupled receptors and second messengers

Page: 432

Hormone-activated phospholipase C can convert phosphatidylinositol 4,5-bisphosphate to:

 

  1. diacylglycerol + inositol triphosphate.
  2. diacylglycerol + inositol+ phosphate.
  3. glycerol + inositol + phosphate.
  4. glycerol + phosphoserine.
  5. phosphatidyl glycerol + inositol + phosphate.

 

  1. G Protein-coupled receptors and second messengers

Pages: 436-437

Calmodulin is a(n):

 

  1. allosteric activator of calcium-dependent enzymes.
  2. allosteric inhibitor of calcium-dependent enzymes.
  3. calcium-dependent enzyme.
  4. cell surface calcium receptor.
  5. regulatory subunit of calcium-dependent enzymes.

 

  1. Receptor tyrosine kinases

Page: 439-440

Which of the following statements concerning signal transduction by the insulin receptor is not correct?

 

  1. Activation of the receptor protein kinase activity results in the activation of additional protein kinases.
  2. Binding of insulin to the receptor activates a protein kinase.
  3. Binding of insulin to the receptor results in a change in its quaternary structure.
  4. The receptor protein kinase activity is specific for tyrosine residues on the substrate proteins.
  5. The substrates of the receptor protein kinase activity are mainly proteins that regulate transcription.

 

 

  1. Multivalent scaffold proteins and membrane rafts in signaling

Pages: 446-448

The specificity of signaling pathways includes all of the following except:

 

  1. flippase-catalyzed movement of phospholipids from the inner to the outer leaflet.
  2. migration of signal proteins into membrane rafts.
  3. phosphorylation of target proteins at Ser, Thr, or Tyr residues.
  4. the ability to be switched off instantly by hydrolysis of a single phosphate-ester bond.
  5. the assembly of large multiprotein complexes.

 

  1. Gated ion channels

Pages: 449-450

The force that drives an ion through a membrane channel depends upon:

 

  1. the charge on the membrane.
  2. the difference in electrical potential across the membrane.
  3. the size of the channel.
  4. the size of the ion.
  5. the size of the membrane.

 

  1. Gated ion channels

Page: 451

The ion channel that opens in response to acetylcholine is an example of a ____________ signal transduction system.

 

  1. G protein
  2. ligand-gated
  3. receptor-enzyme
  4. serpentine receptor
  5. voltage-gated

 

  1. Gated ion channels

Page: 451

The effects of acetylcholine on the postsynaptic ion channel are mainly due to:

 

  1. cyclic nucleotide synthesis.
  2. protein cleavage (proteolysis).
  3. protein conformational changes.
  4. protein phosphorylation.
  5. protein synthesis.

 

  1. Regulation of transcription by steroid hormones

Pages: 456-457

Steroid hormones are carried on specific carrier proteins because the hormones:

 

  1. are too unstable to survive in the blood on their own.
  2. cannot dissolve readily in the blood because they are too hydrophobic.
  3. cannot find their target cells without them.
  4. need them in order to pass through the plasma membrane.
  5. require subsequent binding to specific receptor proteins in the nucleus.

 

  1. Regulation of transcription by steroid hormones

Pages: 456-457

Steriod hormone response elements (HREs) are __________ , which, when bound to _____________, alter gene expession at the level of ________________.

 

  1. intron sequences; activated hormone receptor; translation.
  2. nuclear proteins; hormone; transcription.
  3. plasma membrane proteins; hormone; transcription.
  4. sequences in DNA; receptor-hormone complex; replication.
  5. sequences in DNA; receptor-hormone complex; transcription.

 

  1. Signaling in microorganisms and plants

Pages: 457-458

Which one of the following signaling mechanisms is used most predominantly in plants?

 

  1. Cyclic-nucleotide dependent protein kinases
  2. DNA-binding nuclear steroid receptors
  3. G protein-coupled receptors
  4. Protein serine/threonine kinases
  5. Protein tyrosine kinases

 

  1. Signaling in microorganisms and plants

Pages: 460-461

In the plant signaling pathways employing receptor-like kinases (RLKs), which one of the following does not occur?

 

  1. Activation of a MAPK cascade
  2. Autophosphorylation of receptor
  3. Dimerization of receptor
  4. Ligand binding to receptor
  5. Phosphorylation of key proteins on Tyr residues

 

  1. Sensory transduction in vision, olfaction, and gustation

Page: 462

Most transduction systems for hormones and sensory stimuli that involve trimeric G proteins have in common all of the following except:

 

  1. cyclic nucleotides.
  2. nuclear receptors.
  3. receptors that interact with a G protein.
  4. receptors with multiple transmembrane segments.
  5. self-inactivation.

 

 

  1. Sensory transduction in vision, olfaction, and gustation

Page: 468

The G-protein involved in visual signal transduction is:

 

  1. a leukotriene.
  2. a GTP receptor.

 

  1. Regulation of the cell cycle by protein kinases

Pages: 469-470

Which of the following statements concerning cyclin-dependent protein kinases is not correct?

 

  1. Each type of cell contains one specific form (isozyme).
  2. Their activity fluctuates during the cell cycle.
  3. Their activity is regulated by changes in gene expression, protein phosphorylation, and proteolysis.
  4. Their activity is regulated by cyclins.
  5. They can alter the activity of proteins involved in the progression of cells through the cell cycle.

 

  1. Regulation of the cell cycle by protein kinases

Pages: 469-470

Which of the following statements concerning cyclins is not correct?

 

  1. They are activated and degraded during the cell cycle.
  2. They are regulatory subunits for enzymes that catalyze the phosphorylation of proteins.
  3. They can become linked to ubiquitin.
  4. They catalyze the phosphorylation of proteins.
  5. They contain specific amino acid sequences that target them for proteolysis.

 

  1. Regulation of the cell cycle by protein kinases

Page: 471

Ubiquitin is a:

 

  1. component of the electron transport system.
  2. protein kinase.
  3. protein phosphorylase.
  4. protein that tags another protein for proteolysis.

 

  1. Regulation of the cell cycle by protein kinases

Pages: 472-473

Cyclin-dependent protein kinases can regulate the progression of cells through the cell cycle by phosphorylation of proteins such as:

 

  1. retinal rod and cone proteins.
  2. all of the above.

 

  1. Oncogenes, tumor suppressor genes and programmed cell death

      Pages: 473-474

Proto-oncogenes can be transformed to oncogenes by all of the following mechanisms except:

 

  1. chemically induced mutagenesis.
  2. chromosomal rearrangements.
  3. during a viral infection cycle.
  4. elimination of their start signals for translation.
  5. radiation-induced mutation.

 

  1. Oncogenes, tumor suppressor genes and programmed cell death

      Pages: 473-474

Oncogenes are known that encode all of the following except:

 

  1. cytoplasmic G proteins and protein kinases.
  2. DNA-dependent RNA polymerases.
  3. growth factors.
  4. secreted proteins.
  5. transmembrane protein receptors.

 

  1. Oncogenes, tumor suppressor genes and programmed cell death

      Pages: 477-478

Programmed cell death is called:

 

  1. mitotic termination.
  2. oncogenic transformation.

 

 

Short Answer Questions

 

  1. Molecular mechanisms of signal transduction

Pages: 419-420

Describe three factors that contribute to the high degree of sensitivity of signal transduction systems.

 

 

 

  1. Molecular mechanisms of signal transduction

Pages: 419-420

Explain how amplification of a hormonal signal takes place; illustrate with a specific example.

 

  1. Molecular mechanisms of signal transduction

Page: 421

What is a Scatchard plot, and how can it be used to determine the number of receptor molecules on a cell and their affinity for a ligand?

 

 

  1. G Protein-coupled receptors and second messengers

Pages: 426-427

The toxins produced by Bordetella pertussis (which causes whooping cough) and by Vibrio cholerae (which causes cholera) have similar modes of action in toxin-sensitive mammalian cells.  Describe the molecular basis for their toxic effects.

 

 

  1. G Protein-coupled receptors and second messengers

Page: 429

Describe the sequence of biochemical events between the release of epinephrine into the bloodstream and the activation of the enzyme glycogen phosphorylase.

 

  1. G Protein-coupled receptors and second messengers

Pages: 423-433

Signals carried by hormones must eventually be terminated; the response continues for a limited time.  Discuss three different mechanisms for signal termination, using specific systems as examples.

 

 

  1. G Protein-coupled receptors and second messengers

Pages: 423-442

Explain how amplification occurs in signal transductions, with examples from two of these systems:  the b-adrenergic receptor, the insulin receptor, or the vasopressin system via inositol-1,4,5-trisphosphate (IP3).

 

, amplification occurs when a single molecule of signal activates a cascade of catalysts.

 

  1. Receptor enzymes

Page: 443

Explain how the cytokine erythropoetin activates transcription of specific genes essential in blood maturation.

 

 

  1. G Protein-coupled receptors and second messengers

Pages: 423-443

GTP-binding proteins play critical roles in many signal transductions.  Describe two cases in which such proteins act, and compare the role of the G proteins in each case.

 

 

  1. G Protein-coupled receptors and second messengers

Pages: 423-430, 439-442

Compare and contrast the modes of action of epinephrine, acting through the b-adrenergic receptor, and of insulin, acting through the insulin receptor.

 

  1. G Protein-coupled receptors and second messengers

Pages: 436-438

Explain how an increase in cytosolic Ca2+ concentration from 10-8 M to 10-6 M activates a Ca2+ and calmodulin-dependent enzyme.

 

 

  1. Gated ion channels

Pages: 449-453

Compare and contrast ligand-gated and voltage-gated ion channels; give an example of each.

 

  1. Multivalent scaffold proteins and membrane rafts

Pages: 446-447

What is meant by multivalent scaffold proteins in signaling pathways?

 

 

  1. Multivalent scaffold proteins and membrane rafts

Page: 449

Explain the importance of membrane rafts in cell signaling pathways.

 

 

  1. Signaling in microorganisms and plants

Pages: 457-458

What is meant by the two-component system of bacterial cell signaling?

 

 

  1. Signaling in microorganisms and plants

Page: 460

Briefly describe the ethylene detection system of plants.

 

 

  1. Sensory transduction in vision, olfaction, and gustation

Page: 464

How do ligand-gated ion channels play a role in sensory transduction in the eye?

 

Ans

 

  1. Sensory transduction in vision, olfaction, and gustation

Pages: 465-466

Describe the role of G proteins in olfactory sensory transduction

 

  1. Sensory transduction in vision, olfaction, and gustation

Pages: 468

Match the signal input with the result:

Input                            Result

  1. a) light 1) sensory cell depolarizes
  2. b) odorant 2) sensory cell hyperpolarizes
  3. c) sweet molecule 3) no effect on sensory cell membrane potential
  4. d) epinephrine

 

 

  1. Regulation of transcription by steroid hormones

Page: 456        Difficulty: 1

What is the mechanism of action of the drug tamoxifen in the treatment of breast cancer?

 

  1. Regulation of transcription by steroid hormones

Page: 457

Describe two examples of steroid hormone action that occur too rapidly to be the consequence of altered levels of protein synthesis.

 

 

  1. Regulation of cell cycle by protein kinases

Pages: 469-473

What are cyclins?  What is their role in the regulation of the cell cycle?

 

  1. Oncogenes, tumor suppressor genes and programmed cell death

Pages: 473-474

Describe the relationship between a proto-oncogene and an oncogene, and explain how one arises from the other.  Explain how a mutation in the EGF receptor, or in a GTP-binding protein, can lead to unregulated cell division.

 

 

 

  1. Oncogenes, tumor suppressor genes and programmed cell death

Pages: 473-477

Explain why mutations in oncogenes are generally dominant while those in tumor suppressor genes are recessive.

 

 

  1. Oncogenes, tumor suppressor genes and programmed cell death

Page: 474

The product of the erbB oncogene closely resembles the cellular receptor for epidermal growth factor (EGF).  How do the two proteins differ, and how does this difference account for the oncogenic action of the ErbB protein?

 

  1. Oncogenes, tumor suppressor genes and programmed cell death

Pages: 435-442, 472-473

Explain how mutations in the following proteins might result in either loss of responsiveness to a given hormone or production of a continuous signal even in the absence of the hormone:  (a) a mutation in the regulatory (R) subunit of cAMP-dependent protein kinase, making R incapable of binding to the catalytic (C) subunit;  (b) a mutation in a growth factor receptor with protein kinase activity; (c) a defect in a G protein that renders the GTPase activity inactive.

 

 

 

Chapter 13   Principles of Bioenergetics

 

 

 

Multiple Choice Questions

 

  1. Bioenergetics and thermodynamics

Page: 492

If the DG’° of the reaction A ® B is –40 kJ/mol, under standard conditions the reaction:

 

  1. is at equilibrium.
  2. will never reach equilibrium.
  3. will not occur spontaneously.
  4. will proceed at a rapid rate.
  5. will proceed spontaneously from left to right.

 

  1. Bioenergetics and thermodynamics

Page: 492

For the reaction A ® B, DG’° = –60 kJ/mol.  The reaction is started with 10 mmol of A; no B is initially present.  After 24 hours, analysis reveals the presence of 2 mmol of B, 8 mmol of A.  Which is the most likely explanation?

 

  1. A and B have reached equilibrium concentrations.
  2. An enzyme has shifted the equilibrium toward A.
  3. B formation is kinetically slow; equilibrium has not been reached by 24 hours.
  4. Formation of B is thermodynamically unfavorable.
  5. The result described is impossible, given the fact that DG’° is –60 kJ/mol.

 

  1. Bioenergetics and thermodynamics

Page: 492

When a mixture of 3-phosphoglycerate and 2-phosphoglycerate is incubated at 25 °C with phosphoglycerate mutase until equilibrium is reached, the final mixture contains six times as much 2-phosphoglycerate as 3-phosphoglycerate.  Which one of the following statements is most nearly correct, when applied to the reaction as written?  (R = 8.315 J/mol·K; T = 298 K)

 

3-Phosphoglycerate ® 2-phosphoglycerate

 

  1. DG’°  is –4.44 kJ/mol.
  2. DG’° is zero.
  3. DG’°is +12.7 kJ/mol.
  4. DG’°is incalculably large and positive.
  5. DG’° cannot be calculated from the information given.

 

 

 

 

 

 

 

 

  1. Bioenergetics and thermodynamics

Page: 492

When a mixture of glucose 6-phosphate and fructose 6-phosphate is incubated with the enzyme phosphohexose isomerase (which catalyzes the interconversion of these two compounds) until equilibrium is reached, the final mixture contains twice as much glucose 6-phosphate as fructose 6-phosphate.  Which one of the following statements is best applied to this reaction outlined below?

(R = 8.315 J/mol·K; T = 298 K)

Glucose 6-phosphate ® fructose 6-phosphate

 

  1. DG’° is incalculably large and negative.
  2. DG’° is –1.72 kJ/mol.
  3. DG’° is
  4. DG’° is +1.72 kJ/mol.
  5. DG’° is incalculably large and positive.

 

  1. Bioenergetics and thermodynamics

Page: 492

Hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase is 99% complete at equilibrium (i.e., only 1% of the substrate remains). Which of the following statements is most nearly correct? (R = 8.315 J/mol·K; T = 298 K)

 

  1. DG’° = –11 kJ/mol
  2. DG’° = –5 kJ/mol
  3. DG’° = 0 kJ/mol
  4. DG’° = +11 kJ/mol
  5. DG’° cannot be determined from the information given.

 

  1. Bioenergetics and thermodynamics

Page: 492

The reaction A + B ® C has a DG’° of –20 kJ/mol at 25° C.  Starting under standard conditions, one can predict that:

 

  1. at equilibrium, the concentration of B will exceed the concentration of A.
  2. at equilibrium, the concentration of C will be less than the concentration of A.
  3. at equilibrium, the concentration of C will be much greater than the concentration of A or B.
  4. C will rapidly break down to A + B.
  5. when A and B are mixed, the reaction will proceed rapidly toward formation of C.

 

  1. Bioenergetics and thermodynamics

Page: 493

Which of the following compounds has the largest negative value for the standard free-energy change (DG’°) upon hydrolysis?

 

  1. Acetic anhydride
  2. Glucose 6-phosphate
  3. Glutamine
  4. Glycerol 3-phosphate
  5. Lactose

 

 

  1. Bioenergetics and thermodynamics

Page: 494

For the following reaction, DG’° = +29.7 kJ/mol.

L-Malate + NAD+ ® oxaloacetate + NADH + H+

The reaction as written:

 

  1. can never occur in a cell.
  2. can occur in a cell only if it is coupled to another reaction for which DG’° is positive.
  3. can occur only in a cell in which NADH is converted to NAD+ by electron transport.
  4. cannot occur because of its large activation energy.
  5. may occur in cells at some concentrations of substrate and product.

 

  1. Bioenergetics and thermodynamics

Page: 494

For the reaction A ® B, the Keq is 104.  If a reaction mixture originally contains 1 mmol of A and no B, which one of the following must be true?

 

  1. At equilibrium, there will be far more B than A.
  2. The rate of the reaction is very slow.
  3. The reaction requires coupling to an exergonic reaction in order to proceed.
  4. The reaction will proceed toward B at a very high rate.
  5. DG’° for the reaction will be large and positive.

 

  1. Bioenergetics and thermodynamics

Page: 494

In glycolysis, fructose 1,6-bisphosphate is converted to two products with a standard free-energy change (DG’°) of 23.8 kJ/mol.  Under what conditions encountered in a normal cell will the free-energy change (DG) be negative, enabling the reaction to proceed spontaneously to the right?

 

  1. Under standard conditions, enough energy is released to drive the reaction to the right.
  2. The reaction will not go to the right spontaneously under any conditions because the DG’° is positive.
  3. The reaction will proceed spontaneously to the right if there is a high concentration of products relative to the concentration of fructose 1,6-bisphosphate.
  4. The reaction will proceed spontaneously to the right if there is a high concentration of fructose 1,6-bisphosphate relative to the concentration of products.
  5. None of the above conditions is sufficient.

 

 

  1. Bioenergetics and thermodynamics

Page: 494

During glycolysis, glucose 1-phosphate is converted to fructose 6-phosphate in two successive reactions:

Glucose 1-phosphate ® glucose 6-phosphate         DG’° = –7.1 kJ/mol

Glucose 6-phosphate ® fructose 6-phosphate        DG’° = +1.7 kJ/mol

DG’° for the overall reaction is:

 

  1. –8.8 kJ/mol.
  2. –7.1 kJ/mol.
  3. –5.4 kJ/mol.
  4. +5.4 kJ/mol.
  5. +8.8 kJ/mol.

 

  1. Bioenergetics and thermodynamics

Pages: 494-495

The standard free-energy changes for the reactions below are given.

Phosphocreatine ® creatine + Pi               DG’° = –43.0 kJ/mol

ATP ®  ADP + Pi                                      DG’° = –30.5 kJ/mol

What is the overall DG’° for the following reaction?

Phosphocreatine + ADP ® creatine + ATP

 

  1. –73.5 kJ/mol
  2. –12.5 kJ/mol
  3. +12.5 kJ/mol
  4. +73.5 kJ/mol
  5. DG’° cannot be calculated without Keq‘.

 

  1. Bioenergetics and thermodynamics

Pages: 494-495

The DG’° values for the two reactions shown below are given.

 

Oxaloacetate + acetyl-CoA + H2O ¾¾® citrate + CoASH               DG’° = –32.2 kJ/mol

citrate

synthase

 

Oxaloacetate + acetate    ¾¾®   citrate                                            DG’° = –1.9 kJ/mol

citrate lyase

 

What is the DG’° for the hydrolysis of acetyl-CoA?

Acetyl-CoA + H2O ¾¾® acetate + CoASH + H+

 

  1. –34.1 kJ/mol
  2. –32.2 kJ/mol
  3. –30.3 kJ/mol
  4. +61.9 kJ/mol
  5. +34.1 kJ/mol

 

 

  1. Chemical Logic and Common Biochemical Reactions

Page: 495-501

The reaction ATP à ADP + Pi is an example of a                          reaction.

 

  1. homolytic cleavage
  2. internal rearrangement
  3. free radical
  4. group transfer
  5. oxidation/reduction

 

  1. Phosphoryl group transfers and ATP

Page: 501-506

All of the following contribute to the large, negative, free-energy change upon hydrolysis of “high-energy” compounds except:

 

  1. electrostatic repulsion in the reactant.
  2. low activation energy of forward reaction.
  3. stabilization of products by extra resonance forms.
  4. stabilization of products by ionization.
  5. stabilization of products by solvation.

 

  1. Phosphoryl group transfers and ATP

Page: 502

The hydrolysis of ATP has a large negative DG’°; nevertheless it is stable in solution due to:

 

  1. entropy stabilization.
  2. ionization of the phosphates.
  3. resonance stabilization.
  4. the hydrolysis reaction being endergonic.
  5. the hydrolysis reaction having a large activation energy.

 

  1. Phosphoryl group transfers and ATP

Page: 504

The hydrolysis of phosphoenolpyruvate proceeds with a DG’° of about –62 kJ/mol. The greatest contributing factors to this reaction are the destabilization of the reactants by electostatic repulsion and stabilization of the product pyruvate by:

 

  1. electrostatic attraction.

 

 

  1. Phosphoryl group transfers and ATP

Page: 505

Which one of the following compounds does not have a large negative free energy of hydrolysis?

 

  1. 1,3-bis phosphoglycerate
  2. 3-phosphoglycerate
  3. ADP
  4. Phosphoenolpyruvate
  5. Thioesters (e.g. acetyl-CoA)

 

  1. Phosphoryl group transfers and ATP

Page: 509

The immediate precursors of DNA and RNA synthesis in the cell all contain:

 

  1. 3′ triphosphates.
  2. 5′ triphosphates.

 

  1. Phosphoryl group transfers and ATP

Pages: 509-510

Muscle contraction involves the conversion of:

 

  1. chemical energy to kinetic energy.
  2. chemical energy to potential energy.
  3. kinetic energy to chemical energy.
  4. potential energy to chemical energy.
  5. potential energy to kinetic energy.

 

  1. Biological oxidation-reduction reactions

Page: 512

Biological oxidation-reduction reactions always involve:

 

  1. direct participation of oxygen.
  2. formation of water.
  3. transfer of electron(s).
  4. transfer of hydrogens.

 

  1. Biological oxidation-reduction reactions

Page: 512

Biological oxidation-reduction reactions never involve:

 

  1. transfer of e from one molecule to another.
  2. formation of free e.
  3. transfer of H+ (or H3O+) from one molecule to another.
  4. formation of free H+ (or H3O+).
  5. none of the above.

 

 

  1. Biological oxidation-reduction reactions

Pages: 512-516

The standard reduction potentials (E’°) for the following half reactions are given.

 

Fumarate + 2H+ + 2e ® succinate              E’° = +0.031 V

FAD + 2H+ + 2e ® FADH2                        E’° = –0.219 V

 

If you mixed succinate, fumarate, FAD, and FADH2 together, all at l M concentrations and in the presence of succinate dehydrogenase, which of the following would happen initially?

 

  1. Fumarate and succinate would become oxidized; FAD and FADH2 would become reduced.
  2. Fumarate would become reduced, FADH2 would become oxidized.
  3. No reaction would occur because all reactants and products are already at their standard concentrations.
  4. Succinate would become oxidized, FAD would become reduced.
  5. Succinate would become oxidized, FADH2 would be unchanged because it is a cofactor.

 

  1. Biological oxidation-reduction reactions

Pages: 512-516

E’° of the NAD+/NADH half reaction is –0.32 V.  The E’° of the oxaloacetate/malate half reaction is –0.175 V.  When the concentrations of NAD+, NADH, oxaloacetate, and malate are all 10–5 M, the “spontaneous” reaction is:

 

  1. Malate + NAD+ ® oxaloacetate + NADH + H+.
  2. Malate + NADH + H+ ® oxaloacetate + NAD+.
  3. NAD+ + NADH + H+ ® malate + oxaloacetate.
  4. NAD+ + oxaloacetate ® NADH + H+ + malate.
  5. Oxaloacetate + NADH + H+ ® malate + NAD+.

 

  1. Biological oxidation-reduction reactions

Page: 517

The structure of NAD+ does not include:

 

  1. a flavin nucleotide.
  2. a pyrophosphate bond.
  3. an adenine nucleotide.
  4. two ribose residues.

 

Short Answer Questions

 

  1. Bioenergetics and thermodynamics

Pages: 490-491

Explain the relationships among the change in the degree of order, the change in entropy, and the change in free energy that occur during a chemical reaction.

 

 

  1. Bioenergetics and thermodynamics

Pages: 491-492

Consider the reaction: A + B ® C + D.  If the equilibrium constant for this reaction is a large number (say, 10,000), what do we know about the standard free-energy change (DG’°) for the reaction?  Describe the relationship between Keq and DG’°.

 

 

  1. Bioenergetics and thermodynamics

Page: 492

The standard free energy change (DG’°) for ATP hydrolysis is –30.5 kJ/mol.  ATP, ADP, and Pi are mixed together at initial concentrations of 1 M of each, then left alone until the reaction:

ADP + Pi ® ATP has come to equilibrium.  For each species (i.e., ATP, ADP, and Pi) indicate whether the concentration will be equal to 1 M, less than 1 M, or greater than 1 M.

 

 

  1. Bioenergetics and thermodynamics

Page: 492

If a 0.1 M solution of glucose 1-phosphate is incubated with a catalytic amount of phospho-glucomutase, the glucose 1-phosphate is transformed to glucose 6-phosphate until equilibrium is reached. At equilibrium, the concentration of glucose 1-phosphate is 4.5 x 10–3 M and that of glucose 6-phosphate is 8.6 x 10–2 M.  Set up the expressions for the calculation of Keq and DG’° for this reaction (in the direction of glucose 6-phosphate formation).  (R = 8.315 J/mol·K; T  = 298 K)

 

  1. Bioenergetics and thermodynamics

Page: 494

What is the difference between DG and DG’° of a chemical reaction?  Describe, quantitatively, the relationship between them.

 

 

  1. Bioenergetics and thermodynamics

Page: 494

The following expression for the actual free-energy change for the reaction

A + B ® C + D is incorrect.

DG = DG’° + RT ln Keq

Why is it wrong, and what is the correct expression for the real free-energy change of this reaction?

 

 

  1. Bioenergetics and thermodynamics

Page: 494

Explain in quantitative terms the circumstances under which the following reaction can proceed.

Citrate ® isocitrate            DG’° = +13.3 kJ/mol

 

 

  1. Bioenergetics and thermodynamics

Pages: 491-495

Explain why each of the following statements is false.

(a)  In a reaction under standard conditions, only the reactants are fixed at 1 M.

(b)  When DG’° is positive, Keq > 1.

(c)  DG and DG’° mean the same thing.

  • When DG’° = 1.0 kJ/mol, Keq = 1.

 

 

  1. Bioenergetics and thermodynamics

Page: 494

In glycolysis, the enzyme pyruvate kinase catalyzes this reaction:

Phosphoenolpyruvate + ADP ® pyruvate + ATP

 

Given the information below, show how you would calculate the equilibrium constant for this reaction. (R = 8.315 J/mol·K; T  = 298 K)

 

Reaction 1) ATP ® ADP + Pi                                            DG’° = –30.5 kJ/mol

Reaction 2) phosphoenolpyruvate ® pyruvate + Pi           DG’° = –61.9 kJ/mol

 

 

  1. Bioenergetics and thermodynamics

Page: 494

Explain what is meant by the statement: “Standard free-energy changes are additive.”  Give an example of the usefulness of this additive property in understanding how cells carry out thermodynamically unfavorable chemical reactions.

 

  1. Bioenergetics and thermodynamics

Page: 494

Given DG’° for each of the following reactions,

  1. ATP ® ADP + Pi                                                DG’° = –30.5 kJ/mol
  2. glucose 6-phosphate ® glucose + Pi                  DG’° = –13.8 kJ/mol

show how you would calculate the standard free-energy change (DG’°) for the reaction:

  1. ATP + glucose ® glucose 6-phosphate + ADP

 

 

 

  1. Chemical Logic and Common Biochemical Reactions

Pages: 496

Classify each of the *ed atoms as an electrophile or an nucleophile:

 

 

  1. Phosphoryl group transfers and ATP

Pages: 501-503

Why is the actual free energy (DG) of hydrolysis of ATP in the cell different from the standard free energy (DG’°)?

  1. Phosphoryl group transfers and ATP

Page: 504

The free energy of hydrolysis of phosphoenolpyruvate is –61.9 kJ/mol.  Rationalize this large, negative value for DG’° in chemical terms.

 

 

  1. Phosphoryl group transfers and ATP

Page: 506

In general, when ATP hydrolysis is coupled to an energy-requiring reaction, the actual reaction often consists of the transfer of a phosphate group from ATP to another substrate, rather than an actual hydrolysis of the ATP.  Explain.

 

 

  1. Phosphoryl group transfers and ATP

Pages: 508-511

The first law of thermodynamics states that the amount of energy in the universe is constant, but that the various forms of energy can be interconverted.  Describe four different types of such energy transduction that occur in living organisms and provide one example for each.

 

 

  1. Biological oxidation-reduction reactions

Pages: 512-513

What is an oxidation?  What is a reduction?  Can an oxidation occur without a simultaneous reduction?  Why or why not?

 

  1. Biological oxidation-reduction reactions

Page: 514

During transfer of two electrons through the mitochondrial respiratory chain, the overall reaction is:

NADH + 1/2 O2 + H+ ® NAD+ + H2O

For this reaction, the difference in reduction potentials for the two half-reactions (DE’°) is +1.14 V.  Show how you would calculate the standard free-energy change, DG’°, for the reaction.  (The Faraday constant, Á, is 96.48 kJ/V·mol.)

 

 

  1. Biological oxidation-reduction reactions

Page: 514

If DE’° for an oxidation-reduction reaction is positive, will DG’° be positive or negative?  What is the equation that relates DG’° and DE’°?

 

  1. Biological oxidation-reduction reactions

Pages: 514-515

Glycerol 3-phosphate dehydrogenase catalyzes the following reversible reaction:

Glycerol 3-phosphate + NAD+ ® NADH + H+ + dihydroxyacetone phosphate

Given the standard reduction potentials below, calculate DG’° for the glycerol 3-phosphate dehydrogenase reaction, proceeding from left to right as shown.  Show your work. (The Faraday constant, Á, is 96.48 kJ/V·mol.)

Dihydroxyacetone phosphate + 2e  + 2H+ ® glycerol 3-phosphate     E’° = –0.29 V

NAD+ + H+ + 2e ® NADH                                                                  E’° = –0.32 V

 

 

  1. Biological oxidation-reduction reactions

Page: 515

For each pair of ions or compounds below, indicate which is the more highly reduced species.

(a)  Co2+/Co+

(b)  Glucose/CO2

(c)  Fe3+/Fe2+

(d)  Acetate/CO2

(e)  Ethanol/acetic acid

(f)  Acetic acid/acetaldehyde

 

.

 

 

 

  1. Biological oxidation-reduction reactions

Page: 515

Lactate dehydrogenase catalyzes the reversible reaction:

Pyruvate + NADH + H+    ®    Lactate + NAD+

Given the following facts (a) tell in which direction the reaction will tend to go if NAD+, NADH, pyruvate, and lactate were mixed, all at 1 M concentrations, in the presence of lactate dehydrogenase at pH 7; (b) calculate DG’° for this reaction.  Show your work.

 

NAD+ + H+ + 2e ® NADH                E’° = –0.32 V

pyruvate + 2H+ + 2e ® lactate           E’° = –0.19 V

The Faraday constant, Á, is 96.48 kJ/V·mol.

 

 

  1. Biological oxidation-reduction reactions

Page: 515

Alcohol dehydrogenase catalyzes the following reversible reaction:

Acetaldehyde + NADH + H+ ® Ethanol + NAD+

Use the following information to answer the questions below:

Acetaldehyde + 2H+ + 2e ® ethanol              E’° = –0.20 V

NAD+ + H+ + 2e ® NADH                            E’° = –0.32 V

The Faraday constant, Á, is 96.48 kJ/V·mol.

(a)  Calculate DG’° for the reaction as written.  Show your work.

(b)  Given your answer to (a), what is the DG’° for the reaction occurring in the reverse direction?

(c)  Which reaction (forward or reverse) will tend to occur spontaneously under standard conditions?

(d)  In the cell, the reaction actually proceeds in the direction that has a positive DG’°. Explain how this could be possible.

 

 

Chapter 14   Glycolysis, Gluconeogenesis, and the Pentose

                        Phosphate Pathway

 

 

Multiple Choice Questions

 

  1. Glycolysis

Page: 528 

Glycolysis is the name given to a metabolic pathway occurring in many different cell types.  It consists of 11 enzymatic steps that convert glucose to lactic acid.  Glycolysis is an example of:

 

  1. aerobic metabolism.
  2. anabolic metabolism.
  3. a net reductive process.
  4. oxidative phosphorylation.

 

  1. Glycolysis

Pages: 528-531    

The anaerobic conversion of 1 mol of glucose to 2 mol of lactate by fermentation is accompanied by a net gain of:

 

  1. 1 mol of ATP.
  2. 1 mol of NADH.
  3. 2 mol of ATP.
  4. 2 mol of NADH.
  5. none of the above.

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 530 

During strenuous exercise, the NADH formed in the glyceraldehyde 3-phosphate dehydrogenase reaction in skeletal muscle must be reoxidized to NAD+ if glycolysis is to continue.  The most important reaction involved in the reoxidation of NADH is:

 

  1. dihydroxyacetone phosphate ® glycerol 3-phosphate
  2. glucose 6-phosphate ®  fructose 6-phosphate
  3. isocitrate ® a-ketoglutarate
  4. oxaloacetate ®  malate
  5. pyruvate ®  lactate

 

 

 

 

 

 

 

 

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Pages: 528-531    

If glucose labeled with 14C in C-1 were fed to yeast carrying out the ethanol fermentation, where would the 14C label be in the products?

 

  1. In C-1 of ethanol and CO2
  2. In C-1 of ethanol only
  3. In C-2 (methyl group) of ethanol only
  4. In C-2 of ethanol and CO2
  5. In CO2 only

 

  1. Glycolysis

Pages: 531-538    

The conversion of 1 mol of fructose 1,6-bisphosphate to 2 mol of pyruvate by the glycolytic pathway results in a net formation of:

 

  1. 1 mol of NAD+and 2 mol of ATP.
  2. 1 mol of NADH and 1 mol of ATP.
  3. 2 mol of NAD+and 4 mol of ATP.
  4. 2 mol of NADH and 2 mol of ATP.
  5. 2 mol of NADH and 4 mol of ATP.

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Pages: 531-538                

In an anaerobic muscle preparation, lactate formed from glucose labeled in C-3 and C-4 would be labeled in:

 

  1. all three carbon atoms.
  2. only the carbon atom carrying the OH.
  3. only the carboxyl carbon atom.
  4. only the methyl carbon atom.
  5. the methyl and carboxyl carbon atoms.

 

  1. Glycolysis

Page: 530 

Which of the following statements is not true concerning glycolysis in anaerobic muscle?

 

  1. Fructose 1,6-bisphosphatase is one of the enzymes of the pathway.
  2. It is an endergonic process.
  3. It results in net synthesis of ATP.
  4. It results in synthesis of NADH.
  5. Its rate is slowed by a high [ATP]/[ADP] ratio.

 

 

 

 

 

 

 

 

  1. Glycolysis

Pages: 530-531    

When a muscle is stimulated to contract aerobically, less lactic acid is formed than when it contracts anaerobically because:

 

  1. glycolysis does not occur to significant extent under aerobic conditions.
  2. muscle is metabolically less active under aerobic than anaerobic conditions.
  3. the lactic acid generated is rapidly incorporated into lipids under aerobic conditions.
  4. under aerobic conditions in muscle, the major energy-yielding pathway is the pentose phosphate pathway, which does not produce lactate.
  5. under aerobic conditions most of the pyruvate generated as a result of glycolysis is oxidized by the citric acid cycle rather than reduced to lactate.

 

  1. Glycolysis

Pages: 530-531    

Glycolysis in the erythrocyte produces pyruvate that is further metabolized to:

 

  1. CO2.

 

  1. Glycolysis

Page: 532 

When a mixture of glucose 6-phosphate and fructose 6-phosphate is incubated with the enzyme phosphohexose isomerase, the final mixture contains twice as much glucose 6-phosphate as fructose 6-phosphate.  Which one of the following statements is most nearly correct, when applied to the reaction below (R = 8.315 J/mol·K and T = 298 K)?

 

Glucose 6-phosphate ↔ fructose 6-phosphate

 

  1. DG’° is +1.7 kJ/mol.
  2. DG’° is –1.7 kJ/mol.
  3. DG’° is incalculably large and negative.
  4. DG’° is incalculably large and positive.
  5. DG’° is zero.

 

 

 

 

 

 

 

 

 

 

 

 

 

  1. Glycolysis

Page: 534 

In glycolysis, fructose 1,6-bisphosphate is converted to two products with a standard free-energy change (DG’°) of 23.8 kJ/mol.  Under what conditions (encountered in a normal cell) will the free-energy change (DG) be negative, enabling the reaction to proceed to the right?

 

  1. If the concentrations of the two products are high relative to that of fructose 1,6-bisphosphate.
  2. The reaction will not go to the right spontaneously under any conditions because the DG’° is positive.
  3. Under standard conditions, enough energy is released to drive the reaction to the right.
  4. When there is a high concentration of fructose 1,6-bisphosphate relative to the concentration of products.
  5. When there is a high concentration of products relative to the concentration of fructose 1,6-bisphosphate.

 

  1. Glycolysis

Page: 535             

Glucose labeled with 14C in C-1 and C-6 gives rise in glycolysis to pyruvate labeled in:

 

  1. A and C.
  2. all three carbons.
  3. its carbonyl carbon.
  4. its carboxyl carbon.
  5. its methyl carbon.

 

  1. Glycolysis

Page: 535 

If glucose labeled with 14C at C-1 (the aldehyde carbon) were metabolized in the liver, the first radioactive pyruvate formed would be labeled in:

 

  1. all three carbons.
  2. both A and C.
  3. its carbonyl carbon.
  4. its carboxyl carbon.
  5. its methyl carbon.

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 535 

In an anaerobic muscle preparation, lactate formed from glucose labeled in C-2 would be labeled in:

 

  1. all three carbon atoms.
  2. only the carbon atom carrying the OH.
  3. only the carboxyl carbon atom.
  4. only the methyl carbon atom.
  5. the methyl and carboxyl carbon atoms.

 

 

 

 

 

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 535 

If glucose labeled with 14C in C-3 is metabolized to lactate via fermentation, the lactate will contain 14C in:

 

  1. all three carbon atoms.
  2. only the carbon atom carrying the OH.
  3. only the carboxyl carbon atom.
  4. only the methyl carbon atom.
  5. the methyl and carboxyl carbon atoms.

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 535 

Which of these cofactors participates directly in most of the oxidation-reduction reactions in the fermentation of glucose to lactate?

 

  1. ADP
  2. ATP
  3. FAD/FADH2
  4. Glyceraldehyde 3-phosphate
  5. NAD+/NADH

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 535 

In comparison with the resting state, actively contracting human muscle tissue has a:

 

  1. higher concentration of ATP.
  2. higher rate of lactate formation.
  3. lower consumption of glucose.
  4. lower rate of consumption of oxygen
  5. lower ratio of NADH to NAD+.

 

  1. Glycolysis

Pages: 535-538    

The steps of glycolysis between glyceraldehyde 3-phosphate and 3-phosphoglycerate involve all of the following except:

 

  1. ATP synthesis.
  2. catalysis by phosphoglycerate kinase.
  3. oxidation of NADH to NAD+.
  4. the formation of 1,3-bisphosphoglycerate.
  5. utilization of Pi.

 

 

 

 

 

 

 

 

  1. Glycolysis

Page: 536 

The first reaction in glycolysis that results in the formation of an energy-rich compound (i.e., a compound whose hydrolysis has a highly negative DG’°) is catalyzed by:

 

  1. glyceraldehyde 3-phosphate dehydrogenase.
  2. phosphofructokinase-1.
  3. phosphoglycerate kinase.
  4. triose phosphate isomerase.

 

  1. Glycolysis

Page: 536 

Which of the following is a cofactor in the reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase?

 

  1. ATP
  2. Cu2+
  3. heme
  4. NAD+
  5. NADP+

 

  1. Glycolysis

Page: 537             

In the phosphoglycerate mutase reaction, the side chain of which amino acid in the enzyme is transiently phosphorylated as part of the reaction?

 

  1. serine
  2. threonine
  3. tyrosine
  4. histidine
  5. arginine

 

  1. Glycolysis

Page: 538 

Inorganic fluoride inhibits enolase.  In an anaerobic system that is metabolizing glucose as a substrate, which of the following compounds would you expect to increase in concentration following the addition of fluoride?

 

  1. 2-phosphoglycerate
  2. Glucose
  3. Glyoxylate
  4. Phosphoenolpyruvate
  5. Pyruvate

 

  1. Feeder pathways for glycolysis

Page: 543 

Glycogen is converted to monosaccharide units by:

 

  1. glucose-6-phosphatase
  2. glycogen phosphorylase.
  3. glycogen synthase.

 

  1. Feeder pathways for glycolysis

Page: 545             

Galactosemia is a genetic error of metabolism associated with:

 

  1. deficiency of galactokinase.
  2. deficiency of UDP-glucose.
  3. deficiency of UDP-glucose: galactose 1-phosphate uridylyltransferase.
  4. excessive ingestion of galactose.
  5. inability to digest lactose.

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Pages: 546-547    

Which of the following statements is incorrect?

 

  1. Aerobically, oxidative decarboxylation of pyruvate forms acetate that enters the citric acid cycle.
  2. In anaerobic muscle, pyruvate is converted to lactate.
  3. In yeast growing anaerobically, pyruvate is converted to ethanol.
  4. Reduction of pyruvate to lactate regenerates a cofactor essential for glycolysis.
  5. Under anaerobic conditions pyruvate does not form because glycolysis does not occur.

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Pages: 546-547    

The ultimate electron acceptor in the fermentation of glucose to ethanol is:

 

  1. NAD+.

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Pages: 546-547    

In the alcoholic fermentation of glucose by yeast, thiamine pyrophosphate is a coenzyme required by:

 

  1. lactate dehydrogenase.
  2. pyruvate decarboxylase.

 

  1. Gluconeogenesis

Pages: 551-552

Which of the following compounds cannot serve as the starting material for the synthesis of glucose via gluconeogenesis?

 

  1. acetate
  2. glycerol
  3. lactate
  4. oxaloacetate
  5. a-ketoglutarate

 

  1. Gluconeogenesis

Page: 553

An enzyme used in both glycolysis and gluconeogenesis is:

 

  1. 3-phosphoglycerate kinase.
  2. glucose 6-phosphatase.
  3. phosphofructokinase-1.
  4. pyruvate kinase.

 

  1. Gluconeogenesis

Page: 553

Which one of the following statements about gluconeogenesis is false?

 

  1. For starting materials, it can use carbon skeletons derived from certain amino acids.
  2. It consists entirely of the reactions of glycolysis, operating in the reverse direction.
  3. It employs the enzyme glucose 6-phosphatase.
  4. It is one of the ways that mammals maintain normal blood glucose levels between meals.
  5. It requires metabolic energy (ATP or GTP).

 

  1. Gluconeogenesis

Page: 555

All of the following enzymes involved in the flow of carbon from glucose to lactate (glycolysis) are also involved in the reversal of this flow (gluconeogenesis) except:

 

  1. 3-phosphoglycerate kinase.
  2. phosphofructokinase-1.

 

  1. Gluconeogenesis

Pages: 556-557

In humans, gluconeogenesis:

 

  1. can result in the conversion of protein into blood glucose.
  2. helps to reduce blood glucose after a carbohydrate-rich meal.
  3. is activated by the hormone insulin
  4. is essential in the conversion of fatty acids to glucose.
  5. requires the enzyme hexokinase.

 

  1. Gluconeogenesis

Pages: 556-557

Which of the following substrates cannot contribute to net gluconeogenesis in mammalian liver?

 

  1. alanine
  2. glutamate
  3. palmitate
  4. pyruvate
  5. a-ketoglutarate

 

  1. The pentose phosphate pathway of glucose oxidation

Page: 558 

Which of the following statements about the pentose phosphate pathway is correct?

 

  1. It generates 36 mol of ATP per mole of glucose consumed.
  2. It generates 6 moles of CO2 for each mole of glucose consumed
  3. It is a reductive pathway; it consumes NADH.
  4. It is present in plants, but not in animals.
  5. It provides precursors for the synthesis of nucleotides.

 

  1. The pentose phosphate pathway of glucose oxidation

Page: 558 

The main function of the pentose phosphate pathway is to:

 

  1. give the cell an alternative pathway should glycolysis fail.
  2. provide a mechanism for the utilization of the carbon skeletons of excess amino acids.
  3. supply energy.
  4. supply NADH.
  5. supply pentoses and NADPH.

 

  1. The pentose phosphate pathway of glucose oxidation

Page: 558 

The metabolic function of the pentose phosphate pathway is:

 

  1. act as a source of ADP biosynthesis.
  2. generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids.
  3. participate in oxidation-reduction reactions during the formation of H2
  4. provide intermediates for the citric acid cycle.
  5. synthesize phosphorus pentoxide.

 

  1. The pentose phosphate pathway of glucose oxidation

Pages: 558-560    

Which of the following statements about the pentose phosphate pathway is incorrect?

 

  1. It generates CO2 from C-1 of glucose.
  2. It involves the conversion of an aldohexose to an aldopentose.
  3. It is prominant in lactating mammary gland.
  4. It is principally directed toward the generation of NADPH.
  5. It requires the participation of molecular oxygen.

 

  1. The pentose phosphate pathway of glucose oxidation

Pages: 558-560    

Glucose breakdown in certain mammalian and bacterial cells can occur by mechanisms other than classic glycolysis.  In most of these, glucose 6-phosphate is oxidized to 6-phosphogluconate, which is then further metabolized by:

 

  1. an aldolase-type split to form glyceric acid and glyceraldehyde 3-phosphate.
  2. an aldolase-type split to form glycolic acid and erythrose 4-phosphate.
  3. conversion to 1,6-bisphosphogluconate.
  4. decarboxylation to produce keto- and aldopentoses.
  5. oxidation to a six-carbon dicarboxylic acid.

 

  1. The pentose phosphate pathway of glucose oxidation

Pages: 558-560    

Which of the following enzymes acts in the pentose phosphate pathway?

 

  1. 6-phosphogluconate dehydrogenase
  2. Aldolase
  3. Glycogen phosphorylase
  4. Phosphofructokinase-1
  5. Pyruvate kinase

 

  1. The pentose phosphate pathway of glucose oxidation

Pages: 558-560                

The oxidation of 3 mol of glucose by the pentose phosphate pathway may result in the production of:

 

  1. 2 mol of pentose, 4 mol of NADPH, and 8 mol of CO2.
  2. 3 mol of pentose, 4 mol of NADPH, and 3 mol of CO2.
  3. 3 mol of pentose, 6 mol of NADPH, and 3 mol of CO2.
  4. 4 mol of pentose, 3 mol of NADPH, and 3 mol of CO2.
  5. 4 mol of pentose, 6 mol of NADPH, and 6 mol of CO2.

 

  1. The pentose phosphate pathway of glucose oxidation

Pages: 558-560    

Glucose, labeled with 14C in different carbon atoms, is added to a crude extract of a tissue rich in the enzymes of the pentose phosphate pathway.  The most rapid production of 14CO2 will occur when the glucose is labeled in:

 

  1. C-1.
  2. C-3.
  3. C-4.
  4. C-5.
  5. C-6.

 

 

  1. The pentose phosphate pathway of glucose oxidation

Pages: 558-560    

In a tissue that metabolizes glucose via the pentose phosphate pathway, C-1 of glucose would be expected to end up principally in:

 

  1. carbon dioxide.
  2. ribulose 5-phosphate.

 

 

Short Answer Questions

 

  1. Glycolysis

Page: 527 

There are a variety of fairly common human genetic diseases in which enzymes required for the breakdown of fructose, lactose, or sucrose are defective.  However, there are very few cases of people having a genetic disease in which one of the enzymes of glycolysis is severely affected.  Why do you suppose such mutations are seen so rarely?

 

 

  1. Glycolysis

Page: 528 

Define “fermentation” and explain, by describing relevant reactions, how it differs from glycolysis.  Your explanation should include a discussion of the role of NADH in the reaction(s).

 

 

  1. Glycolysis

Pages: 528-529    

In glycolysis there are two reactions that require one ATP each and two reactions that produce one ATP each.  This being the case, how can fermentation of glucose to lactate lead to the net production of two ATP molecules per glucose?

 

 

  1. Glycolysis

Page: 530 

Briefly describe the possible metabolic fates of pyruvate produced by glycolysis in humans, and explain the circumstances that favor each.

 

 

  1. Glycolysis

Page: 530 

Show how NADH is recycled to NAD+ under aerobic conditions and under anaerobic conditions.  Why is it important to recycle NADH produced during glycolysis to NAD+?

 

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 530  Difficulty: 1

The yeast used in brewing the alcoholic beverage beer can break down glucose either aerobically or anaerobically using alcoholic fermentation.  Explain why beer is brewed under anaerobic conditions.

 

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 530 

Explain with words, diagrams, or structures why lactate accumulates in the blood during bursts of very vigorous exercise (such as a 100-meter dash).

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 530 

Describe the fate of pyruvate, formed by glycolysis in animal skeletal muscle, under two conditions: (a) at rest, and (b) during an all-out sprint.  Show enough detail in your answer to explain why pyruvate metabolism is different in these two cases.

 

 

  1. Fates of pyruvate under anaerobic conditions: fermentation

Page: 530 

During strenuous activity, muscle tissue demands large quantities of ATP, compared with resting muscle.  In white skeletal muscle (in contrast with red muscle), ATP is produced almost exclusively by fermentation of glucose to lactate.  If a person had white muscle tissue devoid of the enzyme lactate dehydrogenase, how would this affect his or her metabolism at rest and during strenuous exercise?

 

 

  1. Glycolysis

Page: 531 

All of the intermediated in the glycolytic pathway are phosphorylated.  Give two plausible reasons why this might be advantageous to the cell.

 

  1. Glycolysis

Page: 524 

There are two reactions in glycolysis in which an aldose is isomerized to a ketose.  For one of these reactions draw the structures of the aldose and the ketose.  For both reactions the DG’° is positive.  Briefly explain how the reactions are able to proceed without the input of additional energy.

 

 

  1. Glycolysis

Page: 529 

Describe the part of the glycolytic pathway from fructose 6-phosphate to glyceraldehyde 3-phosphate.  Show structures of intermediates, enzyme names, and indicate where any cofactors participate.

 

 

  1. Glycolysis

Page: 529 

Describe the glycolytic pathway from fructose 1,6-bisphosphate to 1,3-bisphospho-glycerate, showing structures of intermediates and names of enzymes.  Indicate where any cofactors participate.

 

 

 

 

 

 

 

 

 

 

 

  1. Feeder pathways for glycolysis

Page: 529 

Yeast can metabolize D-mannose to ethanol and CO2.  In addition to the glycolytic enzymes, the only other enzyme needed is phosphomannose isomerase, which converts mannose 6-phosphate to fructose 6-phosphate.  If mannose is converted to ethanol and CO2 by the most direct pathway, which of the compounds and cofactors in this list are involved?

 

  1. Lactate
  2. Acetaldehyde
  3. Acetyl-CoA
  4. FAD
  5. Glucose 6-phosphate
  6. Fructose 1-phosphate
  7. Pyruvate
  8. Lipoic acid
  9. Thiamine pyrophosphate
  10. Dihydroxyacetone phosphate

 

 

  1. The pentose phosphate pathway of glucose oxidation

Page: 529 

Rat liver is able to metabolize glucose by both the glycolytic and the pentose phosphate pathways.  Indicate in the blanks if the following are properties of glycolytic (G), pentose phosphate (P), both (G + P), or neither (0):

 

_____ NAD+ is involved.

_____ CO2 is liberated.

_____ Phosphate esters are intermediates.

_____ Glyceraldehyde 3-phosphate is an intermediate.

_____ Fructose 6-phosphate is an intermediate.

 

 

  1. Glycolysis

Page: 529 

In the conversion of glucose to pyruvate via glycolysis, all of the following enzymes participate.  Indicate the order in which they function by numbering them.

  1   hexokinase

_4__ triose phosphate isomerase

_2__ phosphohexose isomerase

_6__ enolase

_5__ glyceraldehyde 3-phosphate dehydrogenase

_7__ pyruvate kinase

_3__ phosphofructokinase-1

 

Which of the enzymes represents a major regulation point in glycolysis?

Which catalyzes a reaction in which ATP is produced?

Which catalyzes a reaction in which NADH is produced?

 

  1. Glycolysis

Page: 532 

The conversion of glucose into glucose 6-phosphate, which must occur in the breakdown of glucose, is thermodynamically unfavorable (endergonic).  How do cells overcome this problem?

 

  1. Glycolysis

Page: 534 

The conversion of glyceraldehyde 3-phosphate to dihydroxyacetone phosphate is catalyzed by triose phosphate isomerase.  The standard free-energy change (DG’°) for this reaction is –7.5 kJ/mol.  Draw the two structures.  Define the equilibrium constant for the reaction and calculate it using only the data given here.  Be sure to show your work.  (R = 8.315 J/mol·K; T = 298 K)

 

  1. Glycolysis

Page: 535 

When glucose is oxidized via glycolysis, the carbon atom that bears the phosphate in the 3-phosphoglycerate formed may have originally been either C-1 or C-6 of the original glucose.  Describe this pathway in just enough detail to explain this fact.

 

 

  1. Glycolysis

Page: 535 

When glucose labeled with a 14C at C-1 (the aldehyde carbon) passes through glycolysis, the glyceraldehyde 3-phosphate that is produced from it still contains the radioactive carbon atom.  Draw the structure of glyceraldehyde 3-phosphate, and circle the atom(s) that would be radioactive.

 

 

 

  1. Glycolysis

Page: 535 

At which point in glycolysis do C-3 and C-4 of glucose become chemically equivalent?

 

 

  1. Glycolysis

Page: 535 

Explain why Pi (inorganic phosphate) is absolutely required for glycolysis to proceed.

 

  1. Glycolysis

Page: 535 

If brewer’s yeast is mixed with pure sugar (glucose) in the absence of phosphate (Pi), no ethanol is produced.  With the addition of a little Pi, ethanol production soon begins.  Explain this observation in 25 words or less.

 

 

  1. Glycolysis

Page: 530 

Draw the structure of 1,3-bisphosphoglycerate. Indicate with an arrow the phosphate ester, and circle the phosphate group for which the free energy of hydrolysis is very high.

 

 

 

 

  1. Glycolysis

Page: 536 

Two reactions in glycolysis produce ATP.  For each of these, show the name and structure of reactant and product, indicate which cofactors participate and where, and name the enzymes.

 

 

  1. Feeder pathways for glycolysis

Page: 543 

Explain why the phosphorolysis of glycogen is more efficient than the hydrolysis of glycogen in mobilizing glucose for the glycolytic pathway.

 

 

  1. Feeder pathways for glycolysis

Page: 543 

Describe the process of glycogen breakdown in muscle.  Include a description of the structure of glycogen, the nature of the breakdown reaction and the breakdown product, and the required enzyme(s).

 

  1. Feeder pathways for glycolysis

Pages: 543-544    

Explain the biochemical basis of the human metabolic disorder called lactose intolerance.

 

 

  1. Gluconeogenesis

Pages: 551-552

What is gluconeogenesis, and what useful purposes does it serve in people?

 

 

  1. Gluconeogenesis

Pages: 553-554

In gluconeogenesis, how do animals convert pyruvate to phosphoenolpyruvate?  Show structures, enzymes, and cofactors.

 

 

  1. The pentose phosphate pathway of glucose oxidation

Page: 558 

The bacterium E. coli can grow in a medium in which the only carbon source is glucose.  How does this organism obtain ribose 5-phosphate for the synthesis of ATP?  (Do not describe ATP synthesis, just the origin of ribose 5-phosphate.)  Show structures and indicate where cofactors participate.

 

 

  1. The pentose phosphate pathway of glucose oxidation

Page: 558  Difficulty: 1

What are the biological functions of the pentose phosphate pathway?

 

  1. The pentose phosphate pathway of glucose oxidation

Page: 560 

An extract of adipose (fat) tissue can metabolize glucose to CO2.  When glucose labeled with 14C in either C-1 or C-6 was added to the extract, 14CO2 was released with the time courses shown below.  What is the major path of glucose oxidation in this extract?  Explain how you reached this conclusion.

 

 

 

Chapter 15   Principles of Metabolic Regulation

 

 

 

Multiple Choice Questions

 

  1. Regulation of metabolic pathways

Page: 571 

Aside from maintaining the integrity of its hereditary material, the most important general metabolic concern of a cell is:

 

  1. keeping its glucose levels high.
  2. maintaining a constant supply and concentration of ATP.
  3. preserving its ability to carry out oxidative phosphorylation.
  4. protecting its enzymes from rapid degradation.
  5. running all its major metabolic pathways at maximum efficiency.

 

  1. Regulation of metabolic pathways

Pages: 574-575    

If the mass action ratio, Q, for a reaction under cellular conditions is larger than the equilibrium constant, Keq, then:

 

  1. the reaction will be at equilibrium.
  2. the reaction will go backward and be endergonic.
  3. the reaction will go backward and be exergonic.
  4. the reaction will go forward and be endergonic.
  5. the reaction will go forward and be exergonic.

 

  1. Regulation of metabolic pathways

Pages: 571-573    

Which one of the following types of mechanisms is not known to play a role in the reversible alteration of enzyme activity?

 

  1. Activation by cleavage of an inactive zymogen
  2. Allosteric response to a regulatory molecule
  3. Alteration of the synthesis or degradation rate of an enzyme
  4. Covalent modification of the enzyme
  5. Interactions between catalytic and regulatory subunits

 

  1. Analysis of metabolic control

Pages: 577-580    

The flux control coefficient for an enzyme in a multistep pathway depends on:

 

  1. A) the concentration of the enzyme itself.
  2. B) the concentration of other enzymes in the pathway.
  3. C) the levels of regulatory molecules.
  4. D) the amounts of substrate molecules present at each step.
  5. E) all of the above.

 

  1. Analysis of metabolic control

Pages: 577-580    

The elasticity coefficient for an enzyme in a multistep pathway depends on:

 

  1. A) the concentration of the enzyme itself.
  2. B) the levels of regulatory molecules.
  3. C) the amounts of substrate molecules present at each step.
  4. D) both A and C.
  5. E) both B and C.

 

  1. Coordinated regulation of glycolysis and gluconeogenesis

Pages: 582-583    

Gluconeogenesis must use “bypass reactions” to circumvent three reactions in the glycolytic pathway that are highly exergonic and essentially irreversible.  Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway?

 

  • Hexokinase
  • Phosphoglycerate kinase
  • Phosphofructokinase-1
  • Pyruvate kinase
  • Triosephosphate isomerase

 

  1. 1, 2, 3
  2. 1, 2, 4
  3. 1, 4, 5
  4. 1, 3, 4
  5. 2, 3, 4

 

  1. Coordinated regulation of glycolysis and gluconeogenesis

Page: 587 

 

There is reciprocal regulation of glycolytic and gluconeogenic reactions interconverting fructose-6-phosphate and fructose-1,6-bisphosphate.  Which one of the following statements about this regulation is not correct?

 

  1. Fructose-2,6-bisphosphate activates phosphofructokinase-1.
  2. Fructose-2,6-bisphosphate inhibits fructose-1,6-bisphosphatase.
  3. The fructose-1,6-bisphosphatase reaction is exergonic.
  4. The phosphofructokinase-1 reaction is endergonic.
  5. This regulation allows control of the direction of net metabolite flow through the pathway.

 

  1. Coordinated regulation of glycogen synthesis and breakdown

Pages: 587-588    

Which of the following statements is true of muscle glycogen phosphorylase?

 

  1. It catalyzes phosphorolysis of the (a1 ® 6) bonds at the branch points of glycogen.
  2. It catalyzes the degradation of glycogen by hydrolysis of glycosidic bonds.
  3. It degrades glycogen to form glucose 6-phosphate.
  4. It exists in an active (a) form and an inactive (b) form that is allosterically regulated by AMP.
  5. It removes glucose residues from the reducing ends of the glycogen chains.

 

  1. Coordinated regulation of glycogen synthesis and breakdown

Page: 588

Which of the following is true of glycogen synthesis and breakdown?

 

  1. Phosphorylation activates the enzyme responsible for breakdown, and inactivates the synthetic enzyme.
  2. Synthesis is catalyzed by the same enzyme that catalyzes breakdown.
  3. The glycogen molecule “grows” at its reducing end.
  4. The immediate product of glycogen breakdown is free glucose.
  5. Under normal circumstances, glycogen synthesis and glycogen breakdown occur simultaneously and at high rates.

 

  1. Coordinated regulation of glycolysis and gluconeogenesis

Pages: 588-589    

Cellular isozymes of pyruvate kinase are allosterically inhibited by:

 

  1. high concentrations of AMP.
  2. high concentrations of ATP.
  3. high concentrations of citrate.
  4. low concentrations of acetyl-CoA.
  5. low concentrations of ATP.

 

  1. Coordinated regulation of glycolysis and gluconeogenesis

Pages: 590-594    

Which of the following statements about gluconeogenesis in animal cells is true?

 

  1. A rise in the cellular level of fructose-2,6-bisphosphate stimulates the rate of gluconeogenesis.
  2. An animal fed a large excess of fat in the diet will convert any fat not needed for energy production into glycogen to be stored for later use.
  3. The conversion of fructose 1,6-bisphosphate to fructose 6-phosphate is not catalyzed by phosphofructokinase-1, the enzyme involved in glycolysis.
  4. The conversion of glucose 6-phosphate to glucose is catalyzed by hexokinase, the same enzyme involved in glycolysis.
  5. The conversion of phosphoenol pyruvate to 2-phosphoglycerate occurs in two steps, including a carboxylation.

 

  1. The metabolism of glycogen in animals

Page: 595 

The enzyme glycogen phosphorylase:

 

  1. catalyzes a cleavage of b (1 ® 4) bonds.
  2. catalyzes a hydrolytic cleavage of (a1 ® 4) bonds.
  3. is a substrate for a kinase.
  4. uses glucose 6-phosphate as a substrate.
  5. uses glucose as a substrate.

 

  1. The metabolism of glycogen in animals

Page: 595 

Glycogen is converted to monosaccharide units by:

 

  1. glucose-6-phosphatase
  2. glycogen phosphorylase.
  3. glycogen synthase.

 

  1. The metabolism of glycogen in animals

Pages: 600-601

Which one of the following statements abour mammalian glycogen synthase is not correct?

 

  1. It is especially predominant in liver and muscle.
  2. The donor molecule is a sugar nucleotide.
  3. The phosphorylated form of this enzyme is inactive.
  4. This enzyme adds glucose units to the nonreducing end of glycogen branches.
  5. This enzyme adds the initial glucose unit to a tyrosine residue in glycogenin.

 

  1. The metabolism of glycogen in animals

Pages: 600-601

The glycogen-branching enzyme catalyzes:

 

  1. degradation of (a1 ® 4) linkages in glycogen
  2. formation of (a1 ® 4) linkages in glycogen.
  3. formation of (a1 ® 6) linkages during glycogen synthesis.
  4. glycogen degradation in tree branches.
  5. removal of unneeded glucose residues at the ends of branches.

 

  1. The metabolism of glycogen in animals

Pages: 601-602

Glycogenin:

 

  1. catalyzes the conversion of starch into glycogen.
  2. is the enzyme responsible for forming branches in glycogen.
  3. is the gene that encodes glycogen synthase.
  4. is the primer on which new glycogen chains are initiated.
  5. regulates the synthesis of glycogen.

 

  1. The metabolism of glycogen in animals

Pages: 600, 605

Which of the following is true of glycogen synthase?

 

  1. Activation of the enzyme involves a phosphorylation.
  2. It catalyzes addition of glucose residues to the nonreducing end of a glycogen chain by formation of (a1 ® 4) bonds.
  3. It uses glucose-6-phosphate as donor of glucose units
  4. The conversion of an active to an inactive form of the enzyme is controlled by the concentration of cAMP.
  5. The enzyme has measurable activity only in liver.

 

  1. Coordinated regulation of glycogen synthesis and breakdown

Page: 603 

Glycogen phosphorylase a can be inhibited at an allosteric site by:

 

 

  1. Coordinated regulation of glycogen synthesis and breakdown

Page: 605 

Which one of the following directly results in the activation of glycogen synthase?

 

  1. Binding of glucose-6-phosphate
  2. Dephosphorylation of multiple residues by phosphoprotein phosphorylase-1 (PP1)
  3. Phosphorylation of specific residues by casein kinase II (CKII)
  4. Phosphorylation of specific residues by glycogen synthase kinase-3 (GSK-3)
  5. The presence of insulin

 

  1. Coordinated regulation of glycogen synthesis and breakdown

Pages: 605-607    

Which one of the following is not a characteristic of phosphoprotein phosphorylase-1 (PP1)?

 

  1. PP1 can be phosphorylated by protein kinase A (PKA).
  2. PP1 can dephosphorylate glycogen phosphorylase, glycogen synthase, and phosphorylase kinase.
  3. PP1 is allosterically activated by glucose-6-phosphate.
  4. PP1 is inhibited by activated glycogen phosphorylase
  5. PP1 is phosphorylated by glycogen synthase kinase-3 (GSK3).

 

 

Short Answer Questions

 

  1. Regulation of metabolic pathways

Pages: 572           

Why is it important for proper cell function that proteins turn over rather than persisting indefinitely after being synthesized?

 

 

  1. Regulation of metabolic pathways

Pages: 571           

Explain the difference between homeostasis and equilibrium.

 

 

  1. Regulation of metabolic pathways

Pages: 571-572    

What are the regulatory implications for the cell with regard to ATP and AMP, given that the former are generally high, and the latter are low?

 

 

  1. Regulation of metabolic pathways

Page: 572 

Describe four major principles of metabolic regulation that have selectively evolved throughout evolution.

 

  1. Regulation of metabolic pathways

Pages: 572-575

In the glycolytic path from glucose to phosphoenolpyruvate, two steps are practically irreversible.  What are these steps, and how is each bypassed in gluconeogenesis?  What advantages does an organism gain from having separate pathways for anabolic and catabolic metabolism?  What are the disadvantages?

 

 

  1. Analysis of metabolic control

Page: 580 

Explain the distinction between metabolic “regulation” and metabolic “control” in a multienzyme pathway.

 

 

  1. Coordinated regulation of glycolysis and gluconeogenesis

Pages: 582-583

What is a “futile cycle”?  Give an example of a potential futile cycle in carbohydrate metabolism, and describe methods used by cells or organisms to avoid the operation of the futile cycle.

 

 

  1. Coordinated regulation of glycolysis and gluconeogenesis

      Pages: 586-587    

Why is citrate, in addition to being a metabolic intermediate in aerobic oxidation of fuels, an important control molecule for a variety of enzymes?

 

 

  1. Coordinated regulation of glycolysis and gluconeogenesis

Pages: 587-588    

Under what circumstances does the bifunctional protein phosphofructokinase-2/fructose 2,6-bisphosphatase (PFK-2/FBPase-2) become phosphorylated, and what are the consequences of its phosphorylation to the glycolytic and gluconeogenic pathways?

 

 

  1. The metabolism of glycogen in animals

Pages: 594-596    

Describe the process of glycogen breakdown in muscle.  Include a description of the structure of glycogen, the nature of the breakdown reaction and the breakdown product, and the required enzyme(s).

 

  1. The metabolism of glycogen in animals

Pages: 595, 600, 603, 605

Glycogen synthesis and glycogen breakdown are catalyzed by separate enzymes.  Contrast the reactions in terms of substrate, cofactors (if any), and regulation.

 

 

  1. The metabolism of glycogen in animals

Pages: 595-597

In mammalian liver, glucose-1-phosphate, the product of glycogen phosphorylase, can enter glycolysis or replenish blood glucose.  Describe the reactions by which these two processes are carried out.

 

 

  1. The metabolism of glycogen in animals

Pages: 598-601

Diagram the pathway from glucose to glycogen; show the participation of cofactors and name the enzymes involved.

 

  1. The metabolism of glycogen in animals

Page: 600

Show the reaction catalyzed by glycogen synthase.

 

 

  1. The metabolism of glycogen in animals

Page: 600

What is the biological advantage of synthesizing glycogen with many branches?

 

 

  1. The metabolism of glycogen in animals

Page: 600

Show all of the reactions that occur in the pathway from galactose to glycogen in an adult human.  You do not need to give structures or name enzymes; just name the intermediates along the path and show any required cofactors.

 

 

  1. The metabolism of glycogen in animals

Pages: 601-602

Explain the role of glycogenin.

 

  1. Coordinated regulation of glycogen synthesis and breakdown

Page: 604 

Order the steps leading to glycogen breakdown resulting from the stimulation of liver cells by glucagon.

 

  • Activation of protein kinase A (PKA)
  • cAMP levels rise
  • Phosphorylation of phosphorylase b
  • Phosphorylation of phosphorylase b kinase
  • Stimulation of adenyl cyclase

 

 

  1. Coordinated regulation of glycogen synthesis and breakdown

Page: 572-605      

Many of the steps in the pathways described in this chapter are essentially irreversible (for A à B DG << 0).  As a result, if the cell wants to carry out the reverse transformation, it must use a different pathway to go from B à A.  For each of the enzymes on the left, pick the enzyme on the right that carries out the reverse transformation (not necessarily the reverse reaction).

 

  1. a) hexokinase 1) glycogen phosphorylase
  2. b) fructose 1,6-bisphosphatase 2) pyruvate carboxylase & PEP carboxylase
  3. c) glycogen synthase 3) phosphofructokinase I
  4. d) pyruvate kinase 4) glucose-6-phosphatase

 

 

 

Chapter 16   The Citric Acid Cycle

 

 

 

Multiple Choice Questions

 

  1. Production of acetyl-CoA (activated acetate)

Page: 617

Which of the following is not true of the reaction catalyzed by the pyruvate dehydrogenase complex?

 

  1. Biotin participates in the decarboxylation.
  2. Both NAD+ and a flavin nucleotide act as electron carriers.
  3. The reaction occurs in the mitochondrial matrix.
  4. The substrate is held by the lipoyl-lysine “swinging arm.”
  5. Two different cofactors containing —SH groups participate.

 

  1. Production of acetyl-CoA (activated acetate)

Page: 617 

Which of the below is not required for the oxidative decarboxylation of pyruvate to form acetyl-CoA?

 

  1. ATP
  2. CoA-SH
  3. FAD
  4. Lipoic acid
  5. NAD+

 

  1. Production of acetyl-CoA (activated acetate)

Page: 617 

Which combination of cofactors is involved in the conversion of pyruvate to acetyl-CoA?

 

  1. Biotin, FAD, and TPP
  2. Biotin, NAD+, and FAD
  3. NAD+, biotin, and TPP
  4. Pyridoxal phosphate, FAD, and lipoic acid
  5. TPP, lipoic acid, and NAD+

 

  1. Production of acetyl-CoA (activated acetate)

Page: 617 

Which of the following statements about the oxidative decarboxylation of pyruvate in aerobic conditions in animal cells is correct?

 

  1. One of the products of the reactions of the pyruvate dehydrogenase complex is a thioester of acetate.
  2. The methyl (—CH3) group is eliminated as CO2.
  3. The process occurs in the cytosolic compartment of the cell.
  4. The pyruvate dehydrogenase complex uses all of the following as cofactors: NAD+, lipoic acid, pyridoxal phosphate (PLP), and FAD.
  5. The reaction is so important to energy production that pyruvate dehydrogenase operates at full speed under all conditions.

 

  1. Production of acetyl-CoA (activated acetate)

Page: 619             

Glucose labeled with 14C in C-3 and C-4 is completely converted to acetyl-CoA via glycolysis and the pyruvate dehydrogenase complex.  What percentage of the acetyl-CoA molecules formed will be labeled with 14C, and in which position of the acetyl moiety will the 14C label be found?

 

  1. 100% of the acetyl-CoA will be labeled at C-1 (carboxyl).
  2. 100% of the acetyl-CoA will be labeled at C-2.
  3. 50% of the acetyl-CoA will be labeled, all at C-2 (methyl).
  4. No label will be found in the acetyl-CoA molecules.
  5. Not enough information is given to answer this question.

 

  1. Reactions of the citric acid cycle

Page: 620             

Which of the following is not true of the citric acid cycle?

 

  1. All enzymes of the cycle are located in the cytoplasm, except succinate dehydrogenase, which is bound to the inner mitochondrial membrane.
  2. In the presence of malonate, one would expect succinate to accumulate.
  3. Oxaloacetate is used as a substrate but is not consumed in the cycle.
  4. Succinate dehydrogenase channels electrons directly into the electron transfer chain.
  5. The condensing enzyme is subject to allosteric regulation by ATP and NADH.

 

  1. Reactions of the citric acid cycle

Page: 621 

Acetyl-CoA labeled with 14C in both of its acetate carbon atoms is incubated with unlabeled oxaloacetate and a crude tissue preparation capable of carrying out the reactions of the citric acid cycle.  After one turn of the cycle, oxaloacetate would have 14C in:

 

  1. all four carbon atoms.
  2. no pattern that is predictable from the information provided.
  3. none of its carbon atoms.
  4. the keto carbon and one of the carboxyl carbons.
  5. the two carboxyl carbons.

 

  1. Reactions of the citric acid cycle

Page: 623             

Malonate is a competitive inhibitor of succinate dehydrogenase.  If malonate is added to a mitochondrial preparation that is oxidizing pyruvate as a substrate, which of the following compounds would you expect to decrease in concentration?

 

  1. Citrate
  2. Fumarate
  3. Isocitrate
  4. Pyruvate
  5. Succinate

 

 

 

 

  1. Reactions of the citric acid cycle
Page: 621

Which of the following is not an intermediate of the citric acid cycle?

 

  1. Acetyl-coA
  2. Citrate
  3. Oxaloacetate
  4. Succinyl-coA
  5. a-Ketoglutarate

 

  1. Reactions of the citric acid cycle

Page: 621             

In mammals, each of the following occurs during the citric acid cycle except:

 

  1. formation of a-ketoglutarate.
  2. generation of NADH and FADH2.
  3. metabolism of acetate to carbon dioxide and water.
  4. net synthesis of oxaloacetate from acetyl-CoA.
  5. oxidation of acetyl-CoA.

 

  1. Reactions of the citric acid cycle

Page: 621                         

Oxaloacetate uniformly labeled with 14C (i.e., with equal amounts of 14C in each of its carbon atoms) is condensed with unlabeled acetyl-CoA.  After a single pass through the citric acid cycle back to oxaloacetate, what fraction of the original radioactivity will be found in the oxaloacetate?

 

  1. all
  2. 1/2
  3. 1/3
  4. 1/4
  5. 3/4

 

  1. Reactions of the citric acid cycle

Page: 621             

Conversion of 1 mol of acetyl-CoA to 2 mol of CO2 and CoA via the citric acid cycle results in the net production of:

 

  1. 1 mol of citrate.
  2. 1 mol of FADH2.
  3. 1 mol of NADH.
  4. 1 mol of oxaloacetate.
  5. 7 mol of ATP.

 

 

 

 

  1. Reactions of the citric acid cycle

Page: 621             

Which one of the following is not associated with the oxidation of substrates by the citric acid cycle?

 

  1. All of the below are involved.
  2. CO2 production
  3. Flavin reduction
  4. Lipoic acid present in some of the enzyme systems
  5. Pyridine nucleotide oxidation

 

  1. Reactions of the citric acid cycle

Page: 621             

The two moles of CO2 produced in the first turn of the citric acid cycle have their origin in the:

 

  1. carboxyl and methylene carbons of oxaloacetate
  2. carboxyl group of acetate and a carboxyl group of oxaloacetate.
  3. carboxyl group of acetate and the keto group of oxaloacetate.
  4. two carbon atoms of acetate.
  5. two carboxyl groups derived from oxaloacetate.

 

  1. Reactions of the citric acid cycle

Pages: 623-625    

The oxidative decarboxylation of a-ketoglutarate proceeds by means of multistep reactions in which all but one of the following cofactors are required.  Which one is not required?

 

ATP

Coenzyme A

Lipoic acid

NAD+

Thiamine pyrophosphate

 

  1. Reactions of the citric acid cycle

Pages: 623-625                

The reaction of the citric acid cycle that is most similar to the pyruvate dehydrogenase complex-catalyzed conversion of pyruvate to acetyl-CoA is the conversion of:

 

  1. citrate to isocitrate.
  2. fumarate to malate.
  3. malate to oxaloacetate.
  4. succinyl-CoA to succinate.
  5. a-ketoglutarate to succinyl-CoA.

 

 

 

 

 

  1. Reactions of the citric acid cycle

Pages: 623-625                

Which one of the following enzymatic activities would be decreased by thiamine deficiency?

 

  1. Fumarase
  2. Isocitrate dehydrogenase
  3. Malate dehydrogenase
  4. Succinate dehydrogenase
  5. a-Ketoglutarate dehydrogenase complex

 

  1. Reactions of the citric acid cycle

Page: 626             

The reaction of the citric acid cycle that produces an ATP equivalent (in the form of GTP) by substrate level phosphorylation is the conversion of:

 

  1. citrate to isocitrate.
  2. fumarate to malate.
  3. malate to oxaloacetate.
  4. succinate to fumarate.
  5. succinyl-CoA to succinate.

 

  1. Reactions of the citric acid cycle

Page: 628                         

The standard reduction potentials (E’°) for the following half reactions are given.

 

Fumarate + 2H+ + 2e– ® succinate                 E’° = +0.031 V

FAD + 2H+ + 2e– ® FADH2                           E’° = –0.219 V

 

If succinate, fumarate, FAD, and FADH2, all at l M concentrations, were mixed together in the presence of succinate dehydrogenase, which of the following would happen initially?

 

  1. Fumarate and succinate would become oxidized; FAD and FADH2 would become reduced.
  2. Fumarate would become reduced; FADH2 would become oxidized.
  3. No reaction would occur because all reactants and products are already at their standard concentrations.
  4. Succinate would become oxidized; FAD would become reduced.
  5. Succinate would become oxidized; FADH2 would be unchanged because it is a cofactor, not a substrate.

 

 

 

 

 

  1. Reactions of the citric acid cycle

Page: 628                         

For the following reaction, DG’° = 29.7 kJ/mol.

 

L-Malate + NAD+ ® oxaloacetate + NADH + H+

 

The reaction as written:

 

  1. can never occur in a cell.
  2. can only occur in a cell if it is coupled to another reaction for which DG’° is positive.
  3. can only occur in a cell in which NADH is converted to NAD+ by electron transport.
  4. may occur in cells at certain concentrations of substrate and product.
  5. would always proceed at a very slow rate

 

  1. Reactions of the citric acid cycle

Page: 628             

All of the oxidative steps of the citric acid cycle are linked to the reduction of NAD+ except the reaction catalyzed by:

 

  1. isocitrate dehydrogenase.
  2. malate dehydrogenase.
  3. pyruvate dehydrogenase
  4. succinate dehydrogenase.
  5. the a-ketoglutarate dehydrogenase complex.

 

  1. Reactions of the citric acid cycle

Page: 628             

Which of the following cofactors is required for the conversion of succinate to fumarate in the citric acid cycle?

 

  1. ATP
  2. Biotin
  3. FAD
  4. NAD+
  5. NADP+

 

  1. Reactions of the citric acid cycle

Page: 628             

In the citric acid cycle, a flavin coenzyme is required for:

 

  1. condensation of acetyl-CoA and oxaloacetate.
  2. oxidation of fumarate.
  3. oxidation of isocitrate.
  4. oxidation of malate.
  5. oxidation of succinate.

 

 

 

 

 

  1. Reactions of the citric acid cycle

Page: 629             

Which of the following intermediates of the citric acid cycle is prochiral?

 

  1. Citrate
  2. Isocitrate
  3. Malate
  4. Oxaloacetate
  5. Succinate

 

  1. Reactions of the citric acid cycle

Page: 621-632                  

Anaplerotic reactions         .

 

  1. produce oxaloacetate and malate to maintain constant levels of citric acid cycle intermediates
  2. produce biotin needed by pyruvate carboxylase
  3. recycle pantothenate used to make CoA
  4. produce pyruvate and citrate to maintain constant levels of citric acid cycle intermediates
  5. all of the above

 

  1. Reactions of the citric acid cycle

Page: 632             

Intermediates in the citric acid cycle are used as precursors in the biosynthesis of:

 

  1. amino acids
  2. nucleotides
  3. fatty acids
  4. sterols
  5. all of the above

 

  1. Reactions of the citric acid cycle

Page: 630

The conversion of 1 mol of pyruvate to 3 mol of CO2 via pyruvate dehydrogenase and the citric acid cycle also yields _____ mol of NADH, _____ mol of FADH2, and _____ mol of ATP (or GTP).

 

  1. 2; 2;  2
  2. 3; 1;  1
  3. 3; 2;  0
  4. 4; 1;  1
  5. 4; 2;  1

 

  1. Regulation of the citric acid cycle

Page: 636             

Entry of acetyl-CoA into the citric acid cycle is decreased when:

 

  1. [AMP] is high.
  2. NADH is rapidly oxidized through the respiratory chain.
  3. the ratio of [ATP]/[ADP is low
  4. the ratio of [ATP]/[ADP] is high.
  5. the ratio of [NAD+]/[NADH] is high.

 

  1. Regulation of the citric acid cycle

Page: 636             

Citrate synthase and the NAD+-specific isocitrate dehydrogenase are two key regulatory enzymes of the citric acid cycle.  These enzymes are inhibited by:

 

  1. acetyl-CoA and fructose 6-phosphate.
  2. AMP and/or NAD+.
  3. AMP and/or NADH.
  4. ATP and/or NAD+.
  5. ATP and/or NADH.

 

  1. The glyoxylate cycle

Page: 638             

During seed germination, the glyoxylate pathway is important to plants because it enables them to:

 

  1. carry out the net synthesis of glucose from acetyl-CoA.
  2. form acetyl-CoA from malate.
  3. get rid of isocitrate formed from the aconitase reaction.
  4. obtain glyoxylate for cholesterol biosynthesis.
  5. obtain glyoxylate for pyrimidine synthesis.

 

  1. The glyoxylate cycle

Page: 639             

A function of the glyoxylate cycle, in conjunction with the citric acid cycle, is to accomplish the:

 

  1. complete oxidation of acetyl-CoA to CO2 plus reduced coenzymes.
  2. net conversion of lipid to carbohydrate.
  3. net synthesis of four-carbon dicarboxylic acids from acetyl-CoA.
  4. net synthesis of long-chain fatty acids from citric acid cycle intermediates.
  5. both B and C are correct

 

  1. The glyoxylate cycle

Page: 639             

The glyoxylate cycle is:

 

  1. a means of using acetate for both energy and biosynthetic precursors.
  2. an alternative path of glucose metabolism in cells that do not have enough O2.
  3. defective in people with phenylketonuria.
  4. is not active in a mammalian liver.
  5. the most direct way of providing the precursors for synthesis of nucleic acids (e.g., ribose).

 

 

Short Answer Questions

 

  1. Production of acetyl-CoA (activated acetate)

Page: 616 

The citric acid cycle begins with the condensation of acetyl-CoA with oxaloacetate.  Describe three possible sources for the acetyl-CoA.

 

 

  1. Production of acetyl-CoA (activated acetate)

Page: 616  Difficulty: 1

Briefly describe the relationship of the pyruvate dehydrogenase complex reaction to glycolysis and the citric acid cycle.

 

 

 

  1. Production of acetyl-CoA (activated acetate)

Pages: 616-619    

Describe the enzymes, cofactors, intermediates, and products the pyruvate dehydrogenase complex.

 

 

  1. Production of acetyl-CoA (activated acetate)

Page: 617 

Suppose you found an overly high level of pyruvate in a patient’s blood and urine.  One possible cause is a genetic defect in the enzyme pyruvate dehydrogenase, but another plausible cause is a specific vitamin deficiency.  Explain what vitamin might be deficient in the diet, and why that would account for high levels of pyruvate to be excreted in the urine.  How would you determine which explanation is correct?

 

  1. Production of acetyl-CoA (activated acetate)

Page: 619 

Match the cofactors below with their roles in the pyruvate dehydrogenase complex reaction.

 

Cofactors:

  1. Coenzyme A (CoA-SH)
  2. NAD+
  3. Thiamine pyrophosphate (TPP)
  4. FAD
  5. Lipoic acid in oxidized form

 

Roles:

_______ Attacks and attaches to the central carbon in pyruvate.

_______ Oxidizes FADH2.

_______ Accepts the acetyl group from reduced lipoic acid.

_______ Oxidizes the reduced form of lipoic acid.

_______ Initial electron acceptor in oxidation of pyruvate.

 

 

  1. Production of acetyl-CoA (activated acetate)

Page: 619 

Two of the steps in the oxidative decarboxylation of pyruvate to acetyl-CoA do not involve the three carbons of pyruvate, yet are essential to the operation of the pyruvate dehydrogenase complex.  Explain.

.

 

  1. Production of acetyl-CoA (activated acetate)

Page: 619 

What is the function of FAD in the pyruvate dehydrogenase complex?  How is it regenerated?

 

An

 

  1. Production of acetyl-CoA (activated acetate)

Page: 620 

The human disease beriberi is caused by a deficiency of thiamine in the diet.  People with severe beriberi have higher than normal levels of pyruvate in their blood and urine.  Explain this observation in terms of specific enzymatic reaction(s).

 

  1. Reactions of the citric acid cycle

Page: 620 

There are few, if any, humans with defects in the enzymes of the citric acid cycle. Explain this observation in terms of the role of the citric acid cycle.

 

 

  1. Reactions of the citric acid cycle

Page: 621 

Preparation of an extract of muscle results in a dramatic decrease in the concentration of citric acid cycle intermediates compared to their concentrations in the tissue.  However, in 1935, Szent-Gyorgi showed that the production of CO2 by the extract increased when succinate was added.  In fact, for every mole of succinate added, many extra moles of CO2 were produced.  Explain this effect in terms of the known catabolic pathways.

 

 

  1. Reactions of the citric acid cycle

Page: 621 

Draw the citric acid cycle from isocitrate to fumarate only, showing and naming each intermediate.  Show where high-energy phosphate compounds or reduced electron carriers are produced or consumed, and name the enzyme that catalyzes each step.

 

  1. Reactions of the citric acid cycle

Page: 621 

Show the three reactions in the citric acid cycle in which NADH is produced, including the structures.  None of these reactions involves molecular oxygen (O2), but all three reactions are strongly inhibited by anaerobic conditions; explain why.

 

 

  1. Reactions of the citric acid cycle

Page: 621 

At what point in the citric acid cycle do the methyl carbon from acetyl-CoA and the carbonyl carbon from oxaloacetate become chemically equivalent?

 

  1. Reactions of the citric acid cycle

Page: 621 

Show the reactions by which a-ketoglutarate is converted to malate in the citric acid cycle.

 

 

  1. Reactions of the citric acid cycle

Page: 621 

Show the steps of the citric acid cycle in which a six-carbon compound is converted into the first four-carbon intermediate in the path.  For each step, show structures of substrate and product, name the enzyme responsible, and show where cofactors participate.

 

 

  1. Reactions of the citric acid cycle

Page: 621 

Show the structures of the reactants and products for two of the four redox reactions in the citric acid cycle.  Indicate where any cofactors participate, and label the reactants, products, and cofactors as oxidants or reductants in the reaction.

 

 

  1. Reactions of the citric acid cycle

Page: 621 

Show the steps of the citric acid cycle from succinyl-CoA to oxaloacetate only.  For each step, show structures of substrate and product, name the enzyme responsible, and show where cofactors participate.

 

  1. Reactions of the citric acid cycle

Page: 621 

Explain why fluorocitrate, a potent inhibitor of the enzyme aconitase, is a deadly poison.

 

 

  1. Reactions of the citric acid cycle

Page: 621 

The citric acid cycle is frequently described as the major pathway of aerobic catabolism, which means that it is an oxygen-dependent degradative process.  However, none of the reactions of the cycle directly involves oxygen as a reactant.  Why is the pathway oxygen-dependent?

 

 

  1. Reactions of the citric acid cycle

Pages: 623-625    

In the citric acid cycle, a five-carbon compound is decarboxylated to yield an activated four-carbon compound. Show the substrate and product in this step, and indicate where any cofactor(s) participate(s).

 

 

  1. Reactions of the citric acid cycle

Pages: 623-625    

CO2 is produced in two reactions in the citric acid cycle.  For each of these reactions, name and show the structures of reactant and product, name the enzyme, and show how any cofactors participate.

 

 

  1. Reactions of the citric acid cycle

Page: 626 

In which reaction of the citric acid cycle does substrate-level phosphorylation occur?

 

 

  1. Reactions of the citric acid cycle

Page: 628 

Explain in quantitative terms the circumstances under which the following reaction can proceed.

 

L-Malate + NAD+ ® oxaloacetate + NADH + H+              DG’° = +29.7 kJ/mol

 

reaction for which DG’° is positive can proceed under conditions in which the actual DG is negative.  From the relationship

DG = DG’° + RT ln ,

[reactant]

 

  1. Reactions of the citric acid cycle

Page: 631 

You are in charge of genetically engineering a new bacterium that will derive all of its ATP from sunlight by photosynthesis. Will you put the enzymes of the citric acid cycle in this organism?  Briefly explain why or why not.

 

  1. Reactions of the citric acid cycle

Page: 620-630      

Match the cofactor with its function in the citric acid cycle. A given function may be used more than once or not at all.

 

Cofactor                      Function

(a) NAD+/NADH         (1) carries O2

(b) FAD/FADH2           (2) carries small carbon-containing molecules

(c) CoA                                    (3) carries e

(d) thiamine                 (4) carries small nitrogen-containing molecules

(e) biotin

 

  1. The glyoxylate cycle

Pages: 623-624    

Germinating plant seeds can convert stored fatty acids into oxaloacetate and a variety of carbohydrates. Animals cannot synthesize significant quantities of oxaloacetate or glucose from fatty acids.  What accounts for this difference?

 

 

Chapter 17   Fatty Acid Catabolism

 

 

 

Multiple Choice Questions

 

  1. Digestion, mobilization, and transport of fats

Pages: 648-649    

Lipoprotein lipase acts in:

 

  1. hydrolysis of triacylglycerols of plasma lipoproteins to supply fatty acids to various tissues.
  2. intestinal uptake of dietary fat.
  3. intracellular lipid breakdown of lipoproteins.
  4. lipoprotein breakdown to supply needed amino acids.
  5. none of the above.

 

  1. Digestion, mobilization, and transport of fats

Pages: 649-650    

Free fatty acids in the bloodstream are:

 

  1. bound to hemoglobin.
  2. carried by the protein serum albumin.
  3. freely soluble in the aqueous phase of the blood.
  4. nonexistent; the blood does not contain free fatty acids.
  5. present at levels that are independent of epinephrine.

 

  1. Digestion, mobilization, and transport of fats

Pages: 649-650    

The role of hormone-sensitive triacylglycerol lipase is to:

 

  1. hydrolyze lipids stored in the liver.
  2. hydrolyze membrane phospholipids in hormone-producing cells.
  3. hydrolyze triacylglycerols stored in adipose tissue.
  4. synthesize lipids in adipose tissue.
  5. synthesize triacylglycerols in the liver.

 

  1. Digestion, mobilization, and transport of fats

Pages: 650           

The glycerol produced from the hydrolysis of triacylglycerides enters glycolysis as:

 

  1. glucose-6-phosphate.
  2. dihydroxyacetone phosphate.
  3. glyceryl CoA.

 

  1. Digestion, mobilization, and transport of fats

Pages: 650-652    

Transport of fatty acids from the cytoplasm to the mitochondrial matrix requires:

 

  1. ATP, carnitine, and coenzyme A.
  2. ATP, carnitine, and pyruvate dehydrogenase.
  3. ATP, coenzyme A, and hexokinase.
  4. ATP, coenzyme A, and pyruvate dehydrogenase.
  5. carnitine, coenzyme A, and hexokinase.

 

  1. Digestion, mobilization, and transport of fats

Page: 652 

Fatty acids are activated to acyl-CoAs and the acyl group is further transferred to carnitine because:

 

  1. acyl-carnitines readily cross the mitochondrial inner membrane, but acyl-CoAs do not.
  2. acyl-CoAs easily cross the mitochondrial membrane, but the fatty acids themselves will not.
  3. carnitine is required to oxidize NAD+to NADH.
  4. fatty acids cannot be oxidized by FAD unless they are in the acyl-carnitine form.
  5. None of the above is true.

 

  1. Digestion, mobilization, and transport of fats

Pages: 651-652

Carnitine is:

 

  1. a 15-carbon fatty acid.
  2. an essential cofactor for the citric acid cycle.
  3. essential for intracellular transport of fatty acids.
  4. one of the amino acids commonly found in protein.
  5. present only in carnivorous animals.

 

  1. Digestion, mobilization, and transport of fats

Page: 652 

Which of these is able to cross the inner mitochondrial membrane?

 

  1. Acetyl–CoA
  2. Fatty acyl–carnitine
  3. Fatty acyl–CoA
  4. Malonyl–CoA
  5. None of the above can cross.

 

  1. Oxidation of fatty acids

Pages: 652-653    

What is the correct order of function of the following enzymes of b oxidation?

  1. b-Hydroxyacyl-CoA dehydrogenase
  2. Thiolase
  3. Enoyl-CoA hydratase
  4. Acyl-CoA dehydrogenase

 

  1. 1, 2, 3, 4
  2. 3, 1, 4, 2
  3. 4, 3, 1, 2
  4. 1, 4, 3, 2
  5. 4, 2, 3, 1

 

  1. Oxidation of fatty acids

Pages: 654-656    

If the 16-carbon saturated fatty acid palmitate is oxidized completely to carbon dioxide and water (via the b-oxidation pathway and the citric acid cycle), and all of the energy-conserving products are used to drive ATP synthesis in the mitochondrion, the net yield of ATP per molecule of palmitate is:

 

  1. 1,000.

 

  1. Oxidation of fatty acids

Pages: 654-656    

Saturated fatty acids are degraded by the stepwise  reactions of b oxidation, producing acetyl-CoA. Under aerobic conditions, how many ATP molecules would be produced as a consequence of removal of each acetyl-CoA?

 

  1. 2
  2. 3
  3. 4
  4. 5
  5. 6

 

  1. Oxidation of fatty acids

Pages: 650-656    

Which of the following is (are) true of the oxidation of 1 mol of palmitate (a 16-carbon saturated fatty acid; 16:0) by the b-oxidation pathway, beginning with the free fatty acid in the cytoplasm?

 

  1. Activation of the free fatty acid requires the equivalent of two ATPs.
  2. Inorganic pyrophosphate (PPi) is produced.
  3. Carnitine functions as an electron acceptor.
  4. 8 mol of FADH2are formed.
  5. 8 mol of acetyl-CoA are formed.
  6. There is no direct involvement of NAD+.

 

  1. 1 and 5 only
  2. 1, 2, and 5
  3. 1, 2, and 6
  4. 1, 3, and 5
  5. 5 only

 

  1. Oxidation of fatty acids

Pages: 650-658    

Complete oxidation of 1 mole of which fatty acid would yield the most ATP?

 

  1. 16-carbon saturated fatty acid
  2. 18-carbon mono-unsaturated fatty acid
  3. 16-carbon mono-unsaturated fatty acid
  4. 16-carbon poly-unsaturated fatty acid
  5. 14-carbon saturated fatty acid

 

  1. Oxidation of fatty acids

Pages: 650-656    

Which of the following statements apply (applies) to the b oxidation of fatty acids?

  1. The process takes place in the cytosol of mammalian cells.
  2. Carbon atoms are removed from the acyl chain one at a time.
  3. Before oxidation, fatty acids must be converted to their CoA derivatives.
  4. NADP+is the electron acceptor.
  5. The products of b oxidation can directly enter the citric acid cycle for further oxidation.

 

  1. 1 and 3 only
  2. 1, 2, and 3
  3. 1, 2, and 5
  4. 3 and 5 only
  5. 4 only

 

  1. Oxidation of fatty acids

Pages: 650-652                

Which of the following statements concerning the b oxidation of fatty acids is true?

 

  1. About 1,200 ATP molecules are ultimately produced per 20-carbon fatty acid oxidized.
  2. One FADH2 and two NADH are produced for each acetyl-CoA.
  3. The free fatty acid must be carboxylated in the b position by a biotin-dependent reaction before the process of b oxidation commences.
  4. The free fatty acid must be converted to a thioester before the process of b oxidation commences.
  5. Two NADH are produced for each acetyl-CoA.

 

  1. Oxidation of fatty acids

Pages: 650-656                

The balanced equation for the degradation of CH3(CH2)10COOH via the b-oxidation pathway is:

 

  1. A) CH3(CH2)10COOH + 5FAD + 5NAD+ + 6CoA—SH + 5H2O + ATP ®

6 Acetyl-CoA + 5FADH2 + 5NADH + 5H+ + AMP + PPi

  1. B) CH3(CH2)10COOH + 5FAD + 5NAD+ + 6CoA—SH + 5H2O ®

6 Acetyl-CoA + 5FADH2 + 5NADH + 5H+

  1. C) CH3(CH2)10COOH + 6FAD + 6NAD+ + 6CoA—SH + 6H2O + ATP ®

6 Acetyl-CoA + 6FADH2 + 6NADH + 6H+ + AMP + PPi

  1. D) CH3(CH2)10COOH + 6FAD + 6NAD+ + 6CoA—SH + 6H2O ®

6 Acetyl-CoA + 6FADH2 + 6NADH + 6H+

 

  1. Oxidation of fatty acids

Page: 653 

Which compound is an intermediate of the b oxidation of fatty acids?

 

  1. CH3—(CH2)20—CO—COOH
  2. CH3—CH2—CO—CH2—CO—OPO32–
  3. CH3—CH2—CO—CH2—OH
  4. CH3—CH2—CO—CO—S—CoA
  5. CH3—CO—CH2—CO—S—CoA

 

  1. Oxidation of fatty acids

Page: 653 

The conversion of palmitoyl-CoA (16:0) to myristoyl-CoA (14:0) and 1 mol of acetyl-CoA by the b-oxidation pathway results in the net formation of:

 

  1. 1 FADH2and 1 NADH.
  2. 1 FADH2and 1 NADPH.
  3. 1 FADH2, 1 NADH, and 1 ATP.
  4. 2 FADH2and 2 NADH.
  5. 2 FADH2, 2 NADH, and 1 ATP.

 

  1. Oxidation of fatty acids

Pages: 654-656    

Which of the following is not true regarding the oxidation of 1 mol of palmitate (16:0) by the b-oxidation pathway?

 

  1. 1 mol of ATP is needed.
  2. 8 mol of acetyl-CoA are formed.
  3. 8 mol of FADH2are formed.
  4. AMP and PPiare formed.
  5. The reactions occur in the mitochondria.

 

  1. Oxidation of fatty acids

Pages: 654-656                

If an aerobic organism (e.g., the bacterium E. coli) were fed each of the following four compounds as a source of energy, the energy yield per mole from these molecules would be in the order:

 

  1. alanine > glucose > palmitate (16:0)
  2. glucose > alanine > palmitate
  3. glucose > palmitate > alanine
  4. palmitate > alanine > glucose
  5. palmitate > glucose > alanine

 

  1. Oxidation of fatty acids

Pages: 654-656, 657-660 

Which of the following is (are) true of the b oxidation of long-chain fatty acids?

 

  1. The enzyme complex that catalyzes the reaction contains biotin.
  2. FADH2serves as an electron carrier.
  3. NADH serves as an electron carrier.
  4. Oxidation of an 18-carbon fatty acid produces six molecules of propionyl-CoA.
  5. Oxidation of a 15-carbon fatty acid produces at least one propionyl-CoA.

 

  1. 1, 2, and 3
  2. 1, 2, and 5
  3. 2, 3, and 4
  4. 2, 3, and 5
  5. 3 and 5 only

 

  1. Oxidation of fatty acids

Pages: 657-660    

The following fatty acid, in which the indicated carbon is labeled with 14C, is fed to an animal:

14CH3(CH2)9COOH

After allowing 30 minutes for fatty acid b oxidation, the label would most likely be recovered in:

 

  1. acetyl-CoA.
  2. beta-hydroxy butyryl-CoA.
  3. both acetyl-CoA and propionyl-CoA.
  4. palmitoyl-CoA.
  5. propionyl-CoA.

 

  1. Oxidation of fatty acids

Pages: 657-660    

The carbon atoms from a fatty acid with an odd number of carbons will enter the citric acid cycle as acetyl-CoA and:

 

  1. succinyl-CoA.
  2. a-ketoglutarate.

 

  1. Oxidation of fatty acids

Pages: 657-660    

In the disease sprue, vitamin B12 (cobalamin) is poorly absorbed in the intestine, resulting in B12 deficiency. If each of the following fatty acids were in the diet, for which one would the process of fatty acid oxidation be most affected in a patient with sprue?

 

  1. CH3(CH2)10COOH
  2. CH3(CH2)11COOH
  3. CH3(CH2)12COOH
  4. CH3(CH2)14COOH
  5. CH3(CH2)18COOH

 

  1. Oxidation of fatty acids

Pages: 661           

Which enzyme is the major regulatory control point for b-oxidation?

 

  1. pyruvate carboxylase
  2. carnitine acyl transferase I
  3. acetyl CoA dehydrogenase
  4. enoyl CoA isomerase
  5. methylmalonyl CoA mutase

 

  1. Oxidation of fatty acids

Page: 662 

During b oxidation of fatty acids, ___________ is produced in peroxisomes but not in mitochondria.

 

  1. acetyl-CoA
  2. FADH2
  3. H2O
  4. H2O2
  5. NADH

 

 

  1. Oxidation of fatty acids

Pages: 664-665    

When comparing the b-oxidation and w-oxidation pathways, which one of the following statements is correct?

 

  1. b-oxidation and w-oxidation occur in the cytoplasm.
  2. b oxidation occurs at the carboxyl end of the fatty acid whereas w oxidation occurs at the methyl end.
  3. b oxidation occurs at the methyl end of the fatty acid whereas w oxidation occurs at the carboxyl end.
  4. b oxidation occurs mainly in the cytoplasm whereas w oxidation occurs mainly in the mitochondria.
  5. b oxidation occurs mainly in the mitochondria whereas w oxidation occurs mainly in the cytoplasm.

 

  1. Ketone bodies

Page: 666 

Ketone bodies are formed in the liver and transported to the extrahepatic tissues mainly as:

 

  1. acetoacetyl-CoA.
  2. beta-hydroxybutyric acid.
  3. beta-hydroxybutyryl-CoA.
  4. lactic acid.

 

 

 

  1. Ketone bodies

Page: 666 

The major site of formation of acetoacetate from fatty acids is the:

 

  1. adipose tissue.
  2. intestinal mucosa.

 

 

Short Answer Questions

 

  1. Digestion, mobilization, and transport of fats

Page: 647 

Why is it more efficient to store energy as lipid rather than as glycogen?

 

 

  1. Digestion, mobilization, and transport of fats

Page: 651 

In the first step of fatty acid oxidation, the fatty acid (R—COOH) is converted to its coenzyme A derivative in the following reaction:

 

R–COOH + ATP + CoA–SH ® R–CO–S–CoA + AMP + PPi

 

The standard free-energy change (DG’°) for this reaction is –15 kJ/mol

What will tend to make the reaction more favorable when it takes place within a cell?

 

 

  1. Digestion, mobilization, and transport of fats

Pages: 651-652    

The oxidation of acetyl-CoA added to isolated, intact mitochondria is stimulated strongly by carnitine.  Why?

 

 

  1. Oxidation of fatty acids

Page: 653 

The b oxidation of fatty acids begins with this activation reaction:

 

R–CH2–CH2–CH2–COOH + ATP + CoA–SH®

 

R–CH2–CH2–CH2–CO–S–CoA + AMP + PPi

 

What are the next two steps (after transport into the mitochondria)?  Show structures and indicate where any cofactors participate.

 

  1. Oxidation of fatty acids

Page: 653 

Draw the four basic steps in the oxidation of a saturated fatty acid (the b-oxidation pathway). Show structures, name enzymes, and indicate where any cofactors participate.

 

 

  1. Oxidation of fatty acids

Page: 653 

Show the last step in the sequence of the four reactions in the b-oxidation pathway for fatty acid degradation.  Include the structures of reactant and product, the enzyme name, and indicate where any cofactors participate.

 

 

  1. Oxidation of fatty acids

Page: 653 

One of the steps in fatty acid oxidation in mitochondria involves the addition of water across a double bond. What is the next step in the process?  Show structures and indicate where any cofactor(s) participate(s).

 

 

  1. Oxidation of fatty acids

Page: 653 

In the citric acid cycle, a double bond is introduced into a four-carbon compound containing the —CH2—CH2— group, producing fumarate. Show a similar reaction that occurs in the b-oxidation pathway.

 

 

  1. Oxidation of fatty acids

Pages: 653-656    

Write a balanced equation for  the b oxidation of palmitoyl-CoA, a 16-carbon, fully saturated fatty acid, and indicate how much of each product is formed.

  1. Oxidation of fatty acids

Pages: 653-656    

For each two-carbon increase in the length of a saturated fatty acid chain, how many additional moles of ATP can be formed upon complete oxidation of one mole of the fatty acid to CO2 and H2O?

 

 

  1. Oxidation of fatty acids

Pages: 653-656, 660        

Write a balanced equation for the complete oxidation (to acetyl-CoA and any other products that might be formed) of pelargonic acid, CH3(CH2)7COOH.

 

 

  1. Oxidation of fatty acids

Pages: 653-656, 660        

(a)  Describe the steps in the metabolic pathway in which cells oxidize a four-carbon, straight-chain, saturated fatty acid (butyrate; 4:0) to the fragments that enter the citric acid cycle.  Show the structures of intermediates and products, and indicate where any cofactor(s) participate(s).  (b)  In what way would you change or add to your answer if the starting fatty acid had been five carbons long (also straight-chain and saturated)?

 

  1. Oxidation of fatty acids

Pages: 653-656, 660        

An experimenter studying the oxidation of fatty acids in extracts of liver found that when palmitate (16:0) was provided as substrate, it was completely oxidized to CO2.  However, when undecanoic acid (11:0) was added as substrate, incomplete oxidation occurred unless he bubbled CO2 through the reaction mixture.  The addition of the protein avidin, which binds tightly to biotin, prevented the complete oxidation of undecanoic acid even in the presence of CO2, although it had no effect on palmitate oxidation.  Explain these observations in light of what you know of fatty acid oxidation reactions.

 

 

  1. Oxidation of fatty acids

Page: 660 

Two vitamins, biotin and vitamin B12, play crucial roles in the metabolism of propionic acid (propionate). Explain this by showing the steps in which each is essential in propionate metabolism.

 

 

  1. Oxidation of fatty acids

Page: 660 

The total degradation of a fatty acid with an odd number of carbons yields acetyl-CoA and another compound, X.  Show the structure of X, and describe the pathway by which it is converted into a citric acid cycle intermediate, including where any cofactors participate.

 

 

  1. Oxidation of fatty acids

Page: 660 

Show the shortest pathway by which propionyl-CoA can be converted into a citric acid cycle intermediate. Indicate where any cofactors participate.

 

 

  1. Ketone bodies

Pages: 666-667     Difficulty: 1

If you received a laboratory report showing the presence of a high concentration of ketone bodies in the urine of a patient, what disease would you suspect?  Why do ketone bodies accumulate in such patients?

 

  1. Ketone bodies

Pages: 666-667    

Draw the structure of one ketone body, and describe circumstances under which you would expect to find high concentrations of this compound in the urine of a human.

 

 

  1. Ketone bodies

Pages: 666-667    

What are ketone bodies and why do they form during fasting?

 

 

Chapter 18   Amino Acid Oxidation and the Production of Urea

 

 

 

Multiple Choice Questions

 

  1. Metabolic fates of amino groups

Pages: 675-676                

Which of these is not a protease that acts in the small intestine?

 

  1. Chymotrypsin
  2. Elastase
  3. Enteropeptidase
  4. Secretin
  5. Trypsin

 

  1. Metabolic fates of amino groups

Page: 676             

In the digestion of protein that occurs in the small intestine, which enzyme is critical in the activation of zymogens?

 

  1. Enteropeptidase
  2. Hexokinase
  3. Papain
  4. Pepsin
  5. Secretin

 

  1. Metabolic fates of amino groups

Page: 676             

Which of the following is a zymogen that can be converted to an endopeptidase that hydrolyzes peptide bonds adjacent to Lys and Arg residues?

 

  1. Chymotrypsinogen
  2. Pepsin
  3. Pepsinogen
  4. Trypsin
  5. Trypsinogen

 

  1. Metabolic fates of amino groups

Page: 677             

In amino acid catabolism, the first reaction for many amino acids is a(n):

 

  1. decarboxylation requiring thiamine pyrophosphate (TPP).
  2. hydroxylation requiring NADPH and O2.
  3. oxidative deamination requiring NAD+.
  4. reduction requiring pyridoxal phosphate (PLP).
  5. transamination requiring pyridoxal phosphate (PLP).

 

 

 

  1. Metabolic fates of amino groups

Page: 677             

The coenzyme required for all transaminations is derived from:

 

  1. pyridoxine (vitamin B6).
  2. vitamin B12.

 

  1. Metabolic fates of amino groups

Page: 677             

The coenzyme involved in a transaminase reaction is:

 

  1. biotin phosphate.
  2. lipoic acid.
  3. nicotinamide adenine dinucleotide phosphate (NADP+).
  4. pyridoxal phosphate (PLP).
  5. thiamine pyrophosphate (TPP).

 

  1. Metabolic fates of amino groups

Page: 677             

Transamination from alanine to a-ketoglutarate requires the coenzyme:

 

  1. No coenzyme is involved.
  2. pyridoxal phosphate (PLP).
  3. thiamine pyrophosphate (TPP).

 

  1. Metabolic fates of amino groups

Page: 677             

Pyridoxal phosphate is a cofactor in this class of reactions:

 

 

  1. Metabolic fates of amino groups

Pages: 677-678, 680                    

Which of the following is not true of the reaction catalyzed by glutamate dehydrogenase?

 

  1. It is similar to transamination in that it involves the coenzyme pyridoxal phosphate (PLP).
  2. NH4+ is produced.
  3. The enzyme can use either NAD+ or NADP+ as a cofactor.
  4. The enzyme is glutamate-specific, but the reaction is involved in oxidizing other amino acids.
  5. a-Ketoglutarate is produced from an amino acid.

 

 

  1. Metabolic fates of amino groups

Pages: 67-678                  

Glutamate is metabolically converted to a-ketoglutarate and NH4+ by a process described as:

 

  1. oxidative deamination.
  2. reductive deamination.

 

  1. Metabolic fates of amino groups

Page: 680             

The conversion of glutamate to an a-ketoacid and NH4+:

 

  1. does not require any cofactors.
  2. is a reductive deamination.
  3. is accompanied by ATP hydrolysis catalyzed by the same enzyme.
  4. is catalyzed by glutamate dehydrogenase.
  5. requires ATP.

 

  1. Metabolic fates of amino groups

Pages: 681, 683, 696, 698                       

Which of the following conversions require more than one step?

 

  1. Alanine ® pyruvate
  2. Aspartate ® oxaloacetate
  3. Glutamate ® a-ketoglutarate
  4. Phenylalanine ® hydroxyphenylpyruvate
  5. Proline ® glutamate

 

  1. 1 and 4
  2. 1, 2, and 4
  3. 1, 3, and 5
  4. 2, 4, and 5
  5. 4 and 5

 

  1. Nitrogen excretion and the urea cycle

Page: 682             

Urea synthesis in mammals takes place primarily in tissues of the:

 

  1. skeletal muscle.
  2. small intestine.

 

 

 

 

 

  1. Nitrogen excretion and the urea cycle

Page: 683             

Which substance is not involved in the production of urea from NH4+ via the urea cycle?

 

  1. Aspartate
  2. ATP
  3. Carbamoyl phosphate
  4. Malate
  5. Ornithine

 

  1. Nitrogen excretion and the urea cycle

Page: 683             

Which of these directly donates a nitrogen atom for the formation of urea during the urea cycle?

 

  1. Adenine
  2. Aspartate
  3. Creatine
  4. Glutamate
  5. Ornithine

 

  1. Nitrogen excretion and the urea cycle

Pages: 683-685                

Conversion of ornithine to citrulline is a step in the synthesis of:

 

 

  1. Nitrogen excretion and the urea cycle

Pages: 683-684                

In the urea cycle, ornithine transcarbamoylase catalyzes:

 

  1. cleavage of urea to ammonia.
  2. formation of citrulline from ornithine and another reactant.
  3. formation of ornithine from citrulline and another reactant.
  4. formation of urea from arginine.
  5. transamination of arginine.

 

  1. Nitrogen excretion and the urea cycle

Pages: 684-686                

Which of the following statements is false in reference to the mammalian synthesis of urea?

 

  1. Krebs was a major contributor to the elucidation of the pathway involved.
  2. The amino acid arginine is the immediate precursor to urea.
  3. The carbon atom of urea is derived from mitochondrial HCO3.
  4. The precursor to one of the nitrogens of urea is aspartate.
  5. The process of urea production is an energy-yielding series of reactions.

 

  1. Nitrogen excretion and the urea cycle

Pages: 686                       

Which of the following amino acids are essential for humans?

 

  1. alanine
  2. aspartic acid
  3. asparagine
  4. serine
  5. threonine

 

  1. Nitrogen excretion and the urea cycle

Page: 686             

If a person’s urine contains unusually high concentrations of urea, which one of the following diets has he or she probably been eating recently?

 

  1. High carbohydrate, very low protein
  2. Very high carbohydrate, no protein, no fat
  3. Very very high fat, high carbohydrate, no protein
  4. Very high fat, very low protein
  5. Very low carbohydrate, very high protein

 

  1. Pathways of amino acid degradation

Page: 688             

Which of these amino acids can be directly converted into a citric acid cycle intermediate by transamination?

 

  1. glutamic acid
  2. serine
  3. threonine
  4. tyrosine
  5. proline

 

  1. Pathways of amino acid degradation

Page: 688             

Which of these amino acids are both ketogenic and glucogenic?

 

  1. Isoleucine
  2. Valine
  3. Histidine
  4. Arginine
  5. Tyrosine

 

  1. 1 and 5
  2. 1, 3, and 5
  3. 2 and 4
  4. 2, 3, and 4
  5. 2, 4, and 5

 

  1. Pathways of amino acid degradation

Pages: 690                       

Tetrahydrofolate (THF) and its derivatives shuttle                          between different substrates.

 

  1. electrons
  2. H+
  3. acyl groups
  4. one carbon units
  5. NH2 groups

 

  1. Pathways of amino acid degradation

Pages: 691-692                

The amino acids serine, alanine, and cysteine can be catabolized to yield:

 

  1. a-ketoglutarate.
  2. none of the above.

 

  1. Pathways of amino acid degradation

Page: 692             

Serine or cysteine may enter the citric acid cycle as acetyl-CoA after conversion to:

 

  1. succinyl-CoA.

 

  1. Pathways of amino acid degradation

Pages: 696-697                

The human genetic disease phenylketonuria (PKU) can result from:

 

  1. deficiency of protein in the diet.
  2. inability to catabolize ketone bodies.
  3. inability to convert phenylalanine to tyrosine.
  4. inability to synthesize phenylalanine.
  5. production of enzymes containing no phenylalanine.

 

  1. Pathways of amino acid degradation

Page: 701             

In the human genetic disease maple syrup urine disease, the metabolic defect involves:

 

  1. a deficiency of the vitamin niacin.
  2. oxidative decarboxylation.
  3. synthesis of branched chain amino acids.
  4. transamination of an amino acid.
  5. uptake of branched chain amino acids into liver.

 

 

Short Answer Questions

 

  1. Metabolic fates of amino groups

Pages: 675-676    

Describe (briefly) the role of (a) gastrin, (b) pepsinogen, (c) cholecystokinin, and (d) enteropeptidase in protein digestion.

 

 

  1. Metabolic fates of amino groups

Pages: 675-677    

In the treatment of diabetes, insulin is given intravenously.  Why can’t this hormone, a small protein, be taken orally?

 

 

  1. Metabolic fates of amino groups

Page: 676 

Define zymogen and describe the role of one zymogen in protein digestion.

 

 

  1. Metabolic fates of amino groups

Pages: 677-678    

Transamination reactions are catalyzed by a family of enzymes, all of which require __________ as a coenzyme. In the first step of a transamination, the coenzyme in the aldehyde form condenses with the _________ group of an amino acid to form a(n) _________.

 

 

  1. Metabolic fates of amino groups

Page: 677 

Draw the structures of reactants and products in the transamination in which glutamate and pyruvate are the starting materials.  What cofactor is required for this reaction?

 

     

 

  1. Metabolic fates of amino groups

      Page: 677 

Give the name and draw the structure of the a-keto acid resulting when the following amino acids undergo transamination with a-ketoglutarate:  (a) aspartate; (b) alanine.

 

     

  1. Metabolic fates of amino groups

      Page: 679 

Describe, by showing the chemical intermediates, the role of pyridoxal phosphate (PLP) in the transamination of an amino acid.

 

     

  1. Metabolic fates of amino groups

      Pages: 679-680    

Describe the roles of glutamine synthetase and glutaminase in the metabolism of amino groups in mammals.

 

     

  1. Metabolic fates of amino groups

      Page: 680 

Show the reaction in which ammonia is formed from glutamate; include any required cofactors.

 

     

 

  1. Metabolic fates of amino groups

      Pages: 681-682    

Describe the reactions and the role of the glucose-alanine cycle.

 

     

  1. Nitrogen excretion and the urea cycle

      Page: 682 

Why does a mammal go to all of the trouble of making urea from ammonia rather than simply excreting ammonia as many bacteria do?

 

     

  1. Nitrogen excretion and the urea cycle

      Page: 682 

Describe the three general mechanisms for disposing of excess nitrogen obtained in the diet.  Which organisms use each mechanism?

 

     

  1. Nitrogen excretion and the urea cycle

      Page: 683 

Amino acid catabolism involves the breakdown of 20 amino acids all of which contain nitrogen but have different carbon skeletons.  What overall strategy is used to deal with this problem?  Illustrate the strategy with two examples.

 

     

  1. Nitrogen excretion and the urea cycle

      Page: 686 

During starvation, more urea production occurs.  Explain this observation (in 50 words or less).

 

     

  1. Nitrogen excretion and the urea cycle

      Pages: 686-687    

Describe (a) the fundamental nutritional problem faced by individuals with genetic defects in enzymes involved in urea formation and (b) two approaches to treatment of these diseases.

     

  1. Pathways of amino acid degradation

      Pages: 687-688    

Name four amino acids that can be converted directly (in one step) into pyruvate or a citric acid cycle intermediate, and name the intermediate formed from each.

 

     

  1. Pathways of amino acid degradation

Pages: 687-688    

Name one amino acid whose oxidation proceeds via the intermediate shown:  (a) pyruvate; (b) oxaloacetate; (c) a -ketoglutarate; (d) succinyl-CoA; (e) fumarate.

 

 

  1. Pathways of amino acid degradation

Pages: 687-688    

Degradation of amino acids yields compounds that are common intermediates in the major metabolic pathways. Explain the distinction between glucogenic and ketogenic amino acids in terms of their metabolic fates.

 

 

  1. Pathways of amino acid degradation

Pages: 691-692    

There are bacteria for which alanine can serve as the chief energy source; they oxidize the carbon skeleton of this amino acid, thereby generating ATP.  Describe the first step in alanine degradation; show any cofactors that participate.

 

     

 

  1. Pathways of amino acid degradation

Pages: 696-697    

If you received a laboratory report showing the presence of a high concentration of phenylalanine and its metabolites in the urine of a patient, what disease would you suspect?  What defect(s) in metabolism account(s) for the accumulation of phenylalanine in such patients?

 

     

  1. Pathways of amino acid degradation

Pages: 696-697    

Suppose you are responsible for formulating the diet for a 4-year-old boy with phenylketonuria.  How do you decide what kind and amount of protein to include in the diet?

 

      .

 

  1. Pathways of amino acid degradation

Pages: 698-699    

Diagram the degradative pathway from proline to an intermediate of either glycolysis or the citric acid cycle. Show structures of intermediates and indicate where cofactors are involved.

 

     

 

Chapter 19   Oxidative Phosphorylation and Photophosphorylation

 

 

Multiple Choice Questions

 

1.      Electron-transfer reactions in mitochondria

Page: 707

Almost all of the oxygen (O2) one consumes in breathing is converted to:

 

  1. acetyl-CoA.
  2. carbon dioxide (CO2).
  3. carbon monoxide and then to carbon dioxide.
  4. none of the above.

 

  1. Electron-transfer reactions in mitochondria

Pages: 710-713

A new compound isolated from mitochondria is claimed to represent a previously unrecognized carrier in the electron transfer chain.  It is given the name coenzyme Z.  Which line of evidence do you feel is the least conclusive in assigning this compound a position in the electron transfer chain?

 

  1. Alternate oxidation and reduction of the mitochondrion-bound coenzyme Z can be readily demonstrated.
  2. Removal of coenzyme Z from the mitochondria results in a decreased rate of oxygen consumption.
  3. The rate of oxidation and reduction of mitochondrion-bound coenzyme is of the same order of magnitude as the overall rate of electron transfer in mitochondria as measured by oxygen consumption.
  4. The reduction potential of Z is between that of two compounds known to participate in the electron transport chain
  5. When added to a mitochondrial suspension, coenzyme Z is taken up very rapidly and specifically by the mitochondria.

 

  1. Electron-transfer reactions in mitochondria

Pages: 712-713

Antimycin A blocks electron transfer between cytochromes b and c1.  If intact mitochondria were incubated with antimycin A, excess NADH, and an adequate supply of O2, which of the following would be found in the oxidized state?

 

  1. Coenzyme Q
  2. Cytochrome a3
  3. Cytochrome b
  4. Cytochrome e
  5. Cytochrome f

 

 

 

 

 

  1. 5 Electron-transfer reactions in mitochondria

Page: 714

Cyanide, oligomycin, and 2,4-dinitrophenol (DNP) are inhibitors of mitochondrial aerobic phosphorylation.  Which of the following statements correctly describes the mode of action of the three inhibitors?

 

  1. Cyanide and 2,4-dinitrophenol inhibit the respiratory chain, and oligomycin inhibits the synthesis of ATP.
  2. Cyanide inhibits the respiratory chain, whereas oligomycin and 2,4-dinitrophenol inhibit the synthesis of ATP.
  3. Cyanide, oligomycin, and 2,4-dinitrophenol compete with O2for cytochrome oxidase (Complex IV).
  4. Oligomycin and cyanide inhibit synthesis of ATP; 2,4-dinitrophenol inhibits the respiratory chain.
  5. Oligomycin inhibits the respiratory chain, whereas cyanide and 2,4-dinitrophenol prevent the synthesis of ATP.

 

  1. 6 Electron-transfer reactions in mitochondria

Pages: 715-716

In the reoxidation of QH2 by purified ubiquinone-cytochrome c reductase (Complex III) from heart muscle, the overall stoichiometry of the reaction requires 2 mol of cytochrome c per mole of QH2 because:

 

  1. cytochrome c is a one-electron acceptor, whereas QH2is a two-electron donor.
  2. cytochrome c is a two-electron acceptor, whereas QH2is a one-electron donor.
  3. cytochrome c is water soluble and operates between the inner and outer mitochondrial membranes
  4. heart muscle has a high rate of oxidative metabolism, and therefore requires twice as much cytochrome c as QH2for electron transfer to proceed normally.
  5. two molecules of cytochrome c must first combine physically before they are catalytically active.

 

  1. 4 ATP synthesis

Page: 712

If electron transfer in tightly coupled mitochondria is blocked (with antimycin A) between cytochrome b and cytochrome c1, then:

 

  1. all ATP synthesis will stop.
  2. ATP synthesis will continue, but the P/O ratio will drop to one.
  3. electron transfer from NADH will cease, but O2uptake will continue.
  4. electron transfer from succinate to O2will continue unabated.
  5. energy diverted from the cytochromes will be used to make ATP, and the P/O ratio will rise.

 

 

 

 

 

 

 

 

  1. ATP synthesis

Pages: 723-725

In normal mitochondria, the rate of NADH consumption (oxidation) will:

 

  1. be increased in active muscle, decreased in inactive muscle.
  2. be very low if the ATP synthase is inhibited, but increase when an uncoupler is added.
  3. decrease if mitochondrial ADP is depleted.
  4. decrease when cyanide is used to prevent electron transfer through the cytochrome a + a3
  5. All of the above are true.

 

  1. ATP synthesis

Pages: 722-723

Which of the following statements about the chemiosmotic theory is correct?

 

  1. Electron transfer in mitochondria is accompanied by an asymmetric release of protons on one side of the inner mitochondrial membrane.
  2. It predicts that oxidative phosphorylation can occur even in the absence of an intact inner mitochondrial membrance.
  3. The effect of uncoupling reagents is a consequence of their ability to carry electrons through membranes.
  4. The membrane ATP synthase has no significant role in the chemiosmotic theory.
  5. All of the above are correct.

 

  1. ATP synthesis

Pages: 722-723           Difficulty:1

Which of the following statements about the chemiosmotic theory is false?

 

  1. Electron transfer in mitochondria is accompanied by an asymmetric release of protons on one side of the inner mitochondrial membrane.
  2. Energy is conserved as a transmembrane pH gradient.
  3. Oxidative phosphorylation cannot occur in membrane-free preparations.
  4. The effect of uncoupling reagents is a consequence of their ability to carry protons through membranes.
  5. The membrane ATPase, which plays an important role in other hypotheses for energy coupling, has no significant role in the chemiosmotic theory.

 

  1. ATP synthesis

Pages: 722-723

Upon the addition of 2,4-dinitrophenol (DNP) to a suspension of mitochondria carrying out oxidative phosphorylation linked to the oxidation of malate, all of the following occur except:

 

  1. oxygen consumption decreases.
  2. oxygen consumption increases.
  3. the P/O ratio drops from a value of approximately 2.5 to 0.
  4. the proton gradient dissipates.
  5. the rate of transport of electrons from NADH to O2 becomes maximal.

 

 

 

 

  1. ATP synthesis

Page: 724

Uncoupling of mitochondrial oxidative phosphorylation:

 

  1. allows continued mitochondrial ATP formation, but halts O2
  2. halts all mitochondrial metabolism.
  3. halts mitochondrial ATP formation, but allows continued O2
  4. slows down the citric acid cycle.
  5. slows the conversion of glucose to pyruvate by glycolysis.

 

  1. ATP synthesis

Page: 724

2,4-Dinitrophenol and oligomycin inhibit mitochondrial oxidative phosphorylation.  2,4-Dinitrophenol is an uncoupling agent; oligomycin blocks the ATP synthesis reaction itself.  Therefore, 2,4-dinitrophenol will:

 

  1. allow electron transfer in the presence of oligomycin.
  2. allow oxidative phosphorylation in the presence of oligomycin.
  3. block electron transfer in the presence of oligomycin.
  4. diminish O2 consumption in the presence of oligomycin
  5. do none of the above.

 

  1. ATP synthesis

Page: 724

Which of the following statements about energy conservation in the mitochondrion is false?

 

  1. Drug that inhibits the ATP synthase will also inhibit the flow of electrons down the chain of carriers.
  2. For oxidative phosphorylation to occur, it is essential to have a closed membranous structure with an inside and an outside.
  3. The yield of ATP per mole of oxidizable substrate depends on the substrate.
  4. Uncouplers (such as dinitrophenol) have exactly the same effect on electron transfer as inhibitors such as cyanide; both block further electron transfer to oxygen.
  5. Uncouplers “short circuit” the proton gradient, thereby dissipating the proton motive force as heat.

 

  1. ATP synthesis

Page: 725

Which of the following is correct concerning the mitochondrial ATP synthase?

 

  1. It can synthesize ATP after it is extracted from broken mitochondria.
  2. It catalyzes the formation of ATP even though the reaction has a large positive DG’°.
  3. It consists of F0 and F1 subunits, which are transmembrane (integral) polypeptides.
  4. It is actually an ATPase and only catalyzes the hydrolysis of ATP.
  5. When it catalyzes the ATP synthesis reaction, the DG’° is actually close to zero.

 

  1. ATP synthesis

Page: 726

When the DG’° of the ATP synthesis reaction is measured on the surface of the ATP synthase enzyme, it is found to be close to zero.  This is thought to be due to:

 

  1. a very low energy of activation.
  2. enzyme-induced oxygen exchange.
  3. stabilization of ADP relative to ATP by enzyme binding.
  4. stabilization of ATP relative to ADP by enzyme binding.
  5. none of the above.

 

  1. ATP synthesis

Page: 729

During oxidative phosphorylation, the proton motive force that is generated by electron transport is used to:

 

  1. create a pore in the inner mitochondrial membrane.
  2. generate the substrates (ADP and Pi) for the ATP synthase.
  3. induce a conformational change in the ATP synthase.
  4. oxidize NADH to NAD+.
  5. reduce O2to H2

 

  1. ATP synthesis

Page: 730

The oxidation of a particular hydroxy substrate to a keto product by mitochondria has a P/O ratio of less than 2.  The initial oxidation step is very likely directly coupled to the:

 

  1. oxidation of a flavoprotein.
  2. oxidation of a pyridine nucleotide.
  3. reduction of a flavoprotein.
  4. reduction of a pyridine nucleotide.
  5. reduction of cytochrome a3.

 

  1. Regulation of oxidative phosphorylation

      Page: 735

The relative concentrations of ATP and ADP control the cellular rates of:

 

  1. oxidative phosphorylation.
  2. pyruvate oxidation.
  3. the citric acid cycle.
  4. all of the above.

 

 

  1. Regulation of oxidative phosphorylation

Page: 735

The rate of oxidative phosphorylation in mitochondria is controlled primarily by:

 

  1. feedback inhibition by CO2.
  2. the availability of NADH from the TCA cycle.
  3. the concentration of citrate (or) the glycerol-3-phosphate shuttle.
  4. the mass-action ratio of the ATD-ADP system.
  5. the presence of thermogenin.

 

  1. Regulation of oxidative phosphorylation

Page: 736

Mammals produce heat by using the endogenous uncoupling agent:

 

  1. the small molecule 2-4-Dinitrophenol synthesized by the cell.
  2. the protein thermogenin.
  3. the protein thioredoxin.
  4. the protein cytochrome c.
  5. a modified form of the FoF1

 

  1. Mitochondria play key roles in apoptosis and oxidative stress

      Pages: 735-738

Which one of the following best describes the role of mitochondria in apoptosis?

 

  1. Escape of cytochrome c into the cytoplasm.
  2. Increased rate of fatty acid b-oxidation.
  3. Increase in permeability of outer membrane.
  4. Uncoupling of oxidative phosphorylation.
  5. Both A and C are correct.

 

  1. Mitochondrial genes: their origin and the effects of mutation

Pages: 738-741

Mutations in mitochondrial genes play a role in each of the following diseases except:

 

  1. adult onset diabetes.
  2. cystic fibrosis.
  3. hypertrophic cardiomyopathy.
  4. Leber’s hereditary optic neuropathy.
  5. myoclonic epilepsy.

 

  1. Mitochondrial genes: their origin and the effects of mutation

      Pages: 738-741

Which one of the following statements about human mitochondria is true?

 

  1. About 900 mitochondrial proteins are encoded by nuclear genes.
  2. Mitochondrial genes are inherited from both maternal and paternal sources.
  3. rRNA and tRNA are imported from the cytoplasm and used in mitochondrial protein synthesis.
  4. The mitochondrial genome codes for all proteins found in mitochondria.
  5. The mitochondrial genome is not subject to mutations.

 

 

  1. Light absorption
            Pages: 742-743

In photophosphorylation, absorption of light energy in chloroplast “light reactions” leads to:

 

  1. absorption of CO2 and release of O2.
  2. absorption of O2 and release of CO2.
  3. hydrolysis of ATP and reduction of NADP+.
  4. synthesis of ATP and oxidation of NADPH.
  5. use of iron-sulfur proteins.

 

  1. General features of photophosphorylation

Pages: 743-744

Which of the following statements about the light reactions in photosynthetic plants is false?

 

  1. A membrane-bound ATPase couples ATP synthesis to electron transfer.
  2. No CO2 is fixed in the light reactions.
  3. The ultimate electron acceptor is O2.
  4. The ultimate source of electrons for the process is H2
  5. There are two distinct photosystems, linked together by an electron transfer chain.

 

  1. General features of photophosphorylation

Pages: 743-744

The light reactions in photosynthetic higher plants:

 

  1. do not require chlorophyll.
  2. produce ATP and consume NADH.
  3. require the action of a single reaction center.
  4. result in the splitting of H2O, yielding O2.
  5. serve to produce light so that plants can see underground.

 

  1. General features of photophosphorylation

Pages: 723-744

Photosynthetic phosphorylation and oxidative phosphorylation appear to be generally similar processes, both consisting of ATP synthesis coupled to the transfer of electrons along an electron carrier chain.  Which of the following is not true of both processes?

 

  1. Both contain cytochromes and flavins in their electron carrier chains.
  2. Both processes are associated with membranous elements of the cell.
  3. Both use oxygen as a terminal electron acceptor.
  4. Each represents the major route of ATP synthesis in those cells in which it is found.
  5. Protons are pumped from the inside to the outside of both mitochondria and chloroplast membranes

 

 

 

  1. Light absorption
            Pages: 744-745

Oxidative phosphorylation and photophosphorylation share all of the following except:

 

  1. involvement of cytochromes.
  2. participation of quinones.
  3. proton pumping across a membrane to create electrochemical potential.
  4. use of iron-sulfur proteins.

 

 

  1. Light absorption

      Page: 747 

The experimental determination of the effectiveness of light of different colors in promoting photosynthesis is called the:

 

  1. absorption spectrum.
  2. action spectrum.
  3. difference spectrum.
  4. reflectance spectrum.
  5. refraction spectrum.

 

  1. Light absorption

      Pages: 747-748    

In what order do the following five steps occur in the photochemical reaction centers?

 

  • Excitation of the chlorophyll a molecule at the reaction center
  • Replacement of the electron in the reaction center chlorophyll
  • Light excitation of antenna chlorophyll molecule
  • Passage of excited electron to electron-transfer chain
  • Exiton transfer to neighboring chlorophyll

 

  1. 1-2-3-4-5
  2. 3-2-5-4-1
  3. 3-5-1-4-2
  4. 4-2-3-5-1
  5. 5-4-3-2-1

 

  1. The central photochemical event: light-driven electron flow

      Pages: 752-762

Which one of the following is true about reaction centers?

 

  1. Cyanobacteria and plants have two reaction centers arranged in tandem.
  2. Cyanobacteria contain a single reaction center of the Fe-S type.
  3. Green sulfur bacteria have two reaction centers arranged in tandem.
  4. Plant photosystems have a single reaction center of the pheophytin-quinone type.
  5. Purple bacteria contain a single reaction center of the Fe-S type.

 

 

  1. The central photochemical event: light-driven electron flow

      Page: 753

In the photolytic cleavage of water by the oxygen-evolving complex [2H2O ® 4 H+ + 4e + O2], how many photons of light at a wavelength of 680 nm are required?

 

  1. 1
  2. 2
  3. 4
  4. 6
  5. 8

 

  1. ATP synthesis by photophosphorylation

      Page: 759             

Which one of the following statements about photophosphorylation is false?

 

  1. It can be uncoupled from electron flow by agents that dissipate the proton gradient.
  2. The difference in pH between the luminal and stromal side of the thylakoid membrane is 3 pH units.
  3. The luminal side of the thylakoid membrane has a higher pH than the stromal side.
  4. The number of ATPs formed per oxygen molecule is about three.
  5. The reaction centers, electron carriers, and ATP-forming enzymes are located in the thylakoid membrane.

 

  1. ATP synthesis by photophosphorylation

      Page: 759             

Cyclic electron flow in chloroplasts produces:

 

  1. ATP and O2, but not NADPH.
  2. ATP, but not NADPH or O2 .
  3. NADPH, and ATP, but not O2 .
  4. NADPH, but not ATP or O2 .
  5. O2, but not ATP or NADPH.

 

 

Short Answer Questions

 

  1. Electron-transfer reactions in mitochondria

Page: 712

As you read and answer this question, you are (presumably) consuming oxygen.  What single reaction accounts for most of your oxygen consumption?

 

 

  1. Electron-transfer reactions in mitochondria

Page: 712

Show the path of electrons from ubiquinone (Q or coenzyme Q) to oxygen in the mitochondrial respiratory chain.  One of the two compounds (Q and O2) has a standard reduction potential (E’°) of 0.82 V, and the other, 0.045 V.  Which value belongs to each compound?  How did you deduce this?

 

 

  1. Electron-transfer reactions in mitochondria

Pages: 712-717

Diagram the path of electron flow from NADH to the final electron acceptor during electron transport in mitochondria.  For each electron carrier, indicate whether only electrons, or both electrons and protons, are accepted/donated by that carrier.  Indicate with an arrow where electrons from succinate oxidation enter the chain of carriers.

 

  1. Electron-transfer reactions in mitochondria

Pages: 711, 717

A recently discovered bacterium carries out ATP synthesis coupled to the flow of electrons through a chain of carriers to some electron acceptor.  The components of its electron transfer chain differ from those found in mitochondria; they are listed below with their standard reduction potentials.

 

Electron carriers in the newly discovered bacterium:

—————————————————————————————————————

Electrons                   E’°

Oxidant                                       Reductant                         transferred                  (V)

—————————————————————————————————————

NAD+ NADH                              2 –0.32

flavoprotein b (FPb)                   flavoprotein b                          2                       –0.62

(oxidized)                            (reduced)

cytochrome c (Fe3+)                    cytochrome c (Fe2+)                 1                       +0.22

Fe-S protein                                Fe-S protein                              2                       +0.89

(oxidized)                            (reduced)

flavoprotein a (FPa)                   flavoprotein a                          2                       +0.77

(oxidized)                            (reduced)

—————————————————————————————————————

 

(a) Place the electron carriers in the order in which they are most likely to act in carrying electrons.  (b) Is it likely that O2 (for which E’° = 0.82 V) is the final electron acceptor in this organism?  Why or why not?  (c) How would you calculate the maximum number of ATP molecules that could theoretically be synthesized, under standard conditions, per pair of electrons transfered through this chain of carriers?  (The Faraday constant, Á, is 96.48 kJ/V·mol.) DG’° for ATP synthesis is +30.5 kJ/mol.

 

 

  1. Electron-transfer reactions in mitochondria

Page: 717

During electron transfer through the mitochondrial respiratory chain, the overall reaction is:

NADH + 1/2 O2 + H+ ® NAD+ + H2O.  The difference in reduction potentials for the two half-reactions (DE’°) is +1.14 V. Show how you would calculate the standard free-energy change, DG’°, for the reaction as written above.  (The Faraday constant, Á, is 96.48 kJ/V·mol.)

 

  1. Electron-transfer reactions in mitochondria

Page: 717

The standard reduction potential for ubiquinone (Q or coenzyme Q) is 0.045 V, and the standard reduction potential (E’°) for FAD is –0.219 V.  Using these values, show that the oxidation of FADH2 by ubiquinone theoretically liberates enough energy to drive the synthesis of ATP.  The Faraday constant, Á, is 96.48 kJ/V·mol. DG’° for ATP synthesis is +30.5 kJ/mol.

 

  1. The role of mitochondria in apoptosis and oxidative stress

Pages: 720-721

Oxidative stress results when the superoxide anion (O2) is formed as a side reaction of mitochondrial electron transport.  This oxygen anion radical is made nontoxic by the action of four enzymes of the mitochondrial matrix.  Name these four enzymes and briefly describe the role of each in detoxifying the superoxide anion (O2).

 

 

  1. ATP synthesis

Pages: 723-724

Describe, in simple diagrams and a few words, the chemiosmotic theory for coupling oxidation to phosphorylation in mitochondria.

 

 

  1. ATP synthesis

Pages: 723-725

Compound X is an inhibitor of mitochondrial ATP synthesis.  It was observed that when compound X was added to cells, the NAD+/NADH ratio decreased.  Would you expect X to be an uncoupling agent or an inhibitor of respiratory electron transfer?  Explain in 30 words or less.

 

  1. ATP synthesis

Pages: 723-724

Cyanide ion (CN–) blocks electron transfer in mitochondria at the level of cytochrome a + a3.  2,4-Dinitrophenol (DNP) is a potent uncoupler of mitochondrial oxidative phosphorylation.  Add labeled curves to the graphs below to show the effects of adding each of these compounds separately to a suspension of mitochondria supplied with O2, succinate, ADP, and Pi. Arrow: time of drug addition.

 

 

 

  1. ATP synthesis

Pages: 723-725           Difficulty: 1

Give an example of (a) an uncoupler of oxidative phosphorylation, and (b) an inhibitor of respiration.  (c) Describe the difference in the effects of such uncouplers and inhibitors on mitochondrial function.

 

 

  1. ATP synthesis

Pages: 723-725

Mitochondria carrying out oxidative phosphorylation consume oxygen.  Explain what happens to this oxygen, and describe the effect of an uncoupling agent such as 2,4-dinitrophenol on the rate of oxygen consumption. Assume there is a sufficient supply of oxidizable substrate, ADP, and Pi.

 

 

  1. ATP synthesis

                  Page: 722

The skunk cabbage (Symphocarpus foetidus) can maintain a temperature of 10–25 °C higher than the temperature of the surrounding air.  Suggest a mechanism for this.

 

     

 

 

  1. ATP synthesis

Pages: 725-726

When the F1 portion of the ATP synthetase complex is removed from the mitochondrial membrane and studied in solution, it functions as an ATPase.  Why does it not function as an ATP synthetase?

 

  1. ATP synthesis

Pages: 723-736

Using a simple diagram of the chemiosmotic theory, explain why anything that makes the mitochondrial membrane leaky stops ATP synthesis in the mitochondria.

 

 

  1. ATP synthesis

Page: 726

When the DG’° of the ATP synthesis reaction is measured on the surface of the ATP synthase enzyme, it was found to be close to zero.  Describe briefly why this is so.

 

 

  1. ATP synthesis

Pages: 726-729

Explain briefly the current model for how the proton motive force that is generated by electron transport is used to drive the ATP synthesis reaction.

 

  1. Regulation of oxidative phosphorylation

Pages: 732-735

Describe and explain how each of the following manipulations will affect (1) the rate of NADH consumption and (2) the rate of ATP synthesis in mitochondria.

(a) Depletion of ADP

(b) Addition of an uncoupler

(c) Addition of cyanide (CN–)

 

 

  1. Regulation of oxidative phosphorylation

Pages: 732-733

What is respiratory control in mitochondria?  What is accomplished by this control mechanism?

 

 

  1. Regulation of oxidative phosphorylation

Pages: 732-733, 724

In his studies of alcoholic fermentation by yeast, Louis Pasteur noted that the sudden addition of oxygen (O2) to a previously anaerobic culture of fermenting grape juice resulted in a dramatic decrease in the rate of glucose consumption.  This “Pasteur effect” can be counteracted by the addition of 2,4-dinitrophenol (DNP), an uncoupler of oxidative phosphorylation.  (a) Why would the yeast cells consume less glucose in the presence of oxygen?  Can you estimate how much less glucose they would use?  (b) Why would DNP counteract or prevent the Pasteur effect?

 

 

  1. Regulation of oxidative phosphorylation

Page: 736

The compound 2,4-dinitrophenol (DNP), an uncoupler, was briefly used as a weight-loss drug. Some of its effects in people who took the drug included weight loss and higher than normal body temperature.  Some people even died.  Explain the first two effects of the compound in biochemical terms.

 

 

  1. Regulation of oxidative phosphorylation

Page: 735

Although molecular oxygen (O2) does not participate directly in any of the reactions of the citric acid cycle, the cycle operates only when O2 is present.  Explain this observation.

 

 

  1. Regulation of oxidative phosphorylation

Page: 735

Consider a liver cell carrying out the oxidation of glucose under aerobic conditions. Suppose that we added a very potent and specific inhibitor of the mitochondrial ATP synthase, completely inhibiting this enzyme.  Indicate whether each of the following statements about the effect of this inhibitor is true or false; if false, explain in a sentence or two why it is false.

____ (a) ATP production in the cell will quickly drop to zero.

____ (b) The rate of glucose consumption by this cell will decrease sharply.

____ (c) The rate of oxygen consumption will increase.

____ (d) The citric acid cycle will speed up to compensate.

____ (e) The cell will switch to fatty acid oxidation as an alternative to glucose oxidation, and the inhibitor will therefore have no effect on ATP production.

 

 

  1. Mitochondrial genes: their origin and the effects of mutation

Page: 739

Mutations in mitochondrial genes frequently produce diseases that affect the brain and skeletal muscle (mitochondrial encephalomyopathies).  Why are these two tissues particularly sensitive to mitochondrial mutations?

 

  1. Mitochondrial genes: their origin and the effects of mutation

Page: 739

Discuss three lines of evidence that support the theory that mitochondria evolved from endosymbiontic bacteria.

 

 

  1. The role of mitochondria in apoptosis and oxidative stress

Pages: 737-738, 715-716

Cytochrome c plays two distinct and very important roles in mammalian cells:  (1) in the mitochondrial electron transport chain, and (2) in apoptotic cell death.  Describe the roles of cytochrome c in these two processes.

 

  1. General features of photophosphorylation

Pages: 742-743

Photophosphorylation differs from oxidative phosphorylation in that the former requires the input of energy in the form of ___________ to create a good electron donor.  In photophosphorylation, electrons flow through a series of membrane-bound carriers including  ___________ , ___________ , and ___________ proteins, whereas ___________ are pumped across a membrane to create an ___________ potential.

 

 

  1. General features of photophosphorylation

Pages: 742-743

Describe the effect(s) that a mitochondrial uncoupler such as 2,4-dinitrophenol (DNP) would have on photophosphorylation.

 

  1. Light absorption

Page: 747

Discuss how “accessory pigments” are able to extend the range of light absorption of the chlorophylls.  Name some accessory pigments.

 

 

  1. Light absorption

Page: 747

What is an action spectrum, and what do peaks in an action spectrum signify?  Show a typical action spectrum plot for photosynthesis.

 

 

  1. The central photochemical event: light-driven electron flow

Pages: 748, 752

Describe what happens at photosystem I from the point where an antenna chlorophyll molecule absorbs a photon of light to the passage of an electron to NADP+.

 

 

  1. The central photochemical event: light-driven electron flow

      Pages: 749-762

Give five general classes of electron carriers that function in both mitochondrial electron transfer to O2 and photosynthetic electron transfer.

 

     

  1. The central photochemical event: light-driven electron flow

      Pages: 749-762

The processes of oxidative phosphorylation coupled with electron transfer (in mitochondria) and photophosphorylation (in chloroplasts) resemble each other in certain respects.  Describe five ways in which the two processes are similar, and describe three significant differences between the two processes.

 

     

  1. The central photochemical event: light-driven electron flow

      Page: 752

Show the path of electrons from photosystem II to NADPH in the chloroplast.  What is the source of the energy that moves electrons through this path?  Show where oxygen is involved in this pathway.

 

     

 

  1. The central photochemical event: light-driven electron flow

      Page: 752

Plants carrying out photosynthesis produce O2.  Describe the source of this O2, and explain, with chemical equations or schematic diagrams, why O2 production occurs only during daylight hours.

 

     

  1. The central photochemical event: light-driven electron flow

      Page: 753

During photophosphorylation in plants, electrons flow through a series of carriers in the chloroplast.  What is the ultimate donor of electrons, and what is the ultimate acceptor?  What provides the energy to move those electrons?

 

     

  1. The central photochemical event: light-driven electron flow

      Page: 752

Describe what happens when a photon is absorbed by photosystem II; end the description of electron flow at plastoquinone.

 

     

  1. ATP synthesis by photophosphorylation

Pages: 759-761    

DCMU is an herbicide that acts by blocking photosynthetic electron flow from photosystem II (PSII) to the cytochrome b6f complex.  Predict the effect of DCMU on O2 production and on ATP synthesis in the chloroplasts of plants sensitive to DCMU.

 

     

  1. ATP synthesis by photophosphorylation

Page: 760  Difficulty: 1

Given that ~8 photons are required to produce one molecule of O2, roughly how many photons are required to produce one molecule of glucose.

 

     

  1. The Evolution of Oxygenic Photosynthesis

Page: 763  Difficulty: 1

Some photosynthetic bacteria contain the protein bacteriorhodopsin, which absorbs light and pumps protons out of the cell directly.  Briefly describe how such a cell could use bacteriorhodopsin and an H+ATPase to make ATP using light.

 

     

 

Chapter 20   Carbohydrate Biosynthesis in Plants and Bacteria

 

 

Multiple Choice Questions

 

  1. Photosynthetic carbohydrate synthesis

Page: 775

The compound that condenses with CO2 in the first reaction of carbon dioxide assimilation is:

 

  1. 3-phosphoglycerate.
  2. ribose 1,5-bisphosphate.
  3. ribulose 1,5-bisphosphate.
  4. ribulose 5-phosphate.

 

  1. Photosynthetic carbohydrate synthesis

Pages: 779-780

Which of these enzymes is not part of the Calvin cycle?

 

  1. Aldolase
  2. Glyceraldehyde 3-phosphate dehydrogenase
  3. Phosphofructokinase-1
  4. Ribulose-5-phosphate kinase
  5. Transketolase

 

  1. Photosynthetic carbohydrate synthesis

Pages: 780-781

Transketolase requires the coenzyme:

 

  1. cobalamin (vitamin B12).
  2. lipoic acid
  3. pyridoxal phosphate.
  4. tetrahydrofolic acid.
  5. thiamine pyrophosphate.

 

  1. Photosynthetic carbohydrate synthesis

Page: 780

When transketolase acts on fructose 6-phosphate and glyceraldehyde 3-phosphate, the products are:

 

  1. 3-phosphoglycerate and glyceraldehyde 3-phosphate.
  2. 3-phosphoglycerate and two molecules of glyceraldehyde 3-phosphate.
  3. dihydroxyacetone phosphate and glucose 6-phosphate.
  4. xylulose 5-phosphate and erythrose 4-phosphate.
  5. xylulose 5-phosphate and ribose 5-phosphate.

 

 

 

 

 

 

  1. Photosynthetic carbohydrate synthesis

Page: 782

Which of these compounds is not directly involved in the Calvin cycle?

 

  1. Erythrose 4-phosphate
  2. Glyceraldehyde 3-phosphate
  3. Mannose 6-phosphate
  4. Ribulose 5-phosphate
  5. Sedoheptulose 7-phosphate

 

  1. Photosynthetic carbohydrate synthesis

Page: 782

In the carbon assimilation (“dark”) reactions of photosynthesis, the biosynthesis of 1 mol of hexose from 6 mol of carbon dioxide requires:

 

  1. 12 mol of NADPH and 12 mol of ATP.
  2. 12 mol of NADPH and 18 mol of ATP.
  3. 18 mol of NADPH and 12 mol of ATP.
  4. 18 mol of NADPH and 18 mol of ATP.
  5. no NADPH and 12 mol of ATP.

 

  1. Photosynthetic carbohydrate synthesis

Pages: 784, 789

The known mechanisms of activation of rubisco or of other enzymes of the Calvin cycle during illumination include all of the following except:

 

  1. increased stromal pH.
  2. light-driven entry of Mg2+ into the stroma.
  3. phosphorylation by cAMP-dependent protein kinase.
  4. phosphorylation of phosphoenolpyruvate carboxylase.
  5. reduction of a disulfide bridge by thioredoxin.

 

  1. Photosynthetic carbohydrate synthesis

Pages: 784-785

Which of these chloroplast enzymes is not regulated by light?

 

  1. Fructose 1,6-bisphosphatase
  2. Glyceraldehyde-phosphate dehydrogenase
  3. Ribulose 5-phosphate kinase
  4. Sedoheptulose 1,7-bisphosphatase
  5. All of the above are regulated by light.

 

  1. Photosynthetic carbohydrate synthesis

Pages: 784-785

The carbon assimilation (“dark”) reactions of photosynthetic plants:

 

  1. are driven ultimately by the energy of sunlight.
  2. are important to plants, but ultimately of little significance for bacteria and animals.
  3. cannot occur in the light.
  4. yield (reduced) NADH.
  5. yield ATP, which is required for the light reactions.
  6. Photosynthetic carbohydrate synthesis

Pages: 784-785

The assimilation of CO2 into organic compounds (triose phosphates) in green plants:

 

  1. involves condensation of the two-carbon compound acetate with CO2 to form 3-phosphoglycerate.
  2. requires NADPH.
  3. results in the production of ATP.
  4. takes place at equal rates in light and darkness.
  5. takes place in the cytosol.

 

  1. Photorespiration and the C4 and CAM pathways

Pages: 786-787

All are true of photorespiration except:

 

  1. It is driven by light.
  2. It oxidizes substrates to CO2.
  3. It produces O2.
  4. It results from a lack of specificity of the enzyme rubisco.
  5. It results in no fixation of carbon.

 

  1. Photorespiration and the C4 and CAM pathways

Page: 787

The three subcellular organelles involved in the phosphoglycolate salvage pathway are:

 

  1. endoplasmic reticulum, chloroplast, and mitochondrion.
  2. nucleus, endoplasmic reticulum, and chloroplast.
  3. golgi apparatus, chloroplast, and mitochondrion.
  4. mitochondrion, peroxisome, and chloroplast.
  5. peroxisome, endoplasmic reticulum, and chloroplast.

 

  1. Photorespiration and the C4 and CAM pathways

Page: 787

The glycine decarboxylase complex in the leaves of pea or spinach plants is localized mainly in the:

 

  1. endoplasmic reticulum.
  2. cell membrane.

 

  1. Photorespiration and the C4 and CAM pathways

Page: 789

In “C4” plants of tropical origin, the first intermediate into which 14CO2 is fixed is:

 

  1. 3-phosphoglycerate.

 

 

  1. Biosynthesis of starch and sucrose

Page: 791

The synthesis of glycogen, starch, and sucrose all:

 

  1. involve addition of a sugar residue at the reducing end of the growing polymer.
  2. take place in liver and muscle of mammals.
  3. use a sugar nucleotide as substrate.
  4. use glucose 1-phosphate as the only substrate.
  5. use glucose-6-phosphate as substrate.

 

  1. Biosynthesis of starch and sucrose

Page: 791

The synthesis of starch and sucrose in plants uses _________ as the substrate, rather than _________, which is used in the synthesis of glycogen in animal cells.

 

  1. ADP-fructose; UDP-glucose
  2. ADP-glucose; UDP-glucose
  3. fructose 1-phosphate; glucose 1-phosphate
  4. glucose 1-phosphate; glucose 6-phosphate
  5. UDP-glucose; ADP-glucose

 

  1. Biosynthesis of starch and sucrose

Page: 792

The precursors for sucrose biosynthesis are:

 

  1. glucose and fructose
  2. UDP-glucose and fructose 6-phosphate
  3. UDP-fructose and glucose 6-phosphate
  4. UDP-glucose and fructose
  5. UDP-glucose and UDP-fructose

 

  1. Biosynthesis of starch and sucrose

Page: 793

The major regulator of sucrose biosynthesis in plants is:

 

  1. fructose 2,6-bisphosphate
  2. fructose 1,6-bisphosphate
  3. sucrose
  4. glucose and fructose
  5. glucose 6-phosphate

 

  1. Synthesis of cell wall polysaccharides: plant cellulose and bacterial peptidoglycan

Pages: 796-797

A precursor in the synthesis of the peptidoglycan of bacterial cell walls is UDP-:

 

  1. glucuronic acid.
  2. N-acetylglucosamine.

 

  1. Synthesis of cell wall polysaccharides: plant cellulose and bacterial peptidoglycan

Page: 797

Penicillin inhibits the synthesis of peptidoglycan:

 

  1. all of the above.

 

  1. Integration of carbohydrate metabolism in the plant cell

Pages: 797-798     Ans:  E

Which one of the following reactions, cycles, or pathways is not found in plant systems?

 

  1. The Calvin cycle
  2. The gluconeogenesis pathway
  3. The glyoxalate cycle
  4. The rubisco reaction
  5. The urea cycle

 

  1. Integration of carbohydrate metabolism in the plant cell

Pages: 797-798    

Which one of the following cellular organelles is not unique to plant cells, in carrying out the indicated pathway or function of carbohydrate metabolism?

 

  1. Amyloplasts (starch synthesis)
  2. Chloroplasts (Calvin cycle)
  3. Glyoxysomes (glyoxlate cycle)
  4. Mitochondria (citric acid cycle)
  5. Vacuoles (organic acid storage)

 

  1. Integration of carbohydrate metabolism in the plant cell

Pages: 798-800     Ans:  B

Which one of the following sugar phosphates is not part of the pool of readily interconvertible metabolites used by the plant cell?

 

  1. Dihydroxyacetone phosphate
  2. Fructose 2,6-bisphosphate
  3. Glucose 1-phosphate
  4. 6-phosphogluconate
  5. Xylulose 5-phosphate

 

  1. Integration of carbohydrate metabolism in the plant cell

Pages: 799-800

When glycerol is converted to glucose via gluconeogenesis in germinating seeds, the first glycolytic intermediate formed is:

 

  1. 1,3-bisphosphoglycerate.
  2. dihydroxyacetone phosphate.
  3. glycerol 1,3-bisphosphate.
  4. glycerol 3-phosphate.
  5. ribulose 1,5-bisphosphate.

 

 

Short Answer Questions

 

  1. Photosynthetic carbohydrate synthesis

Page: 775

Show the reaction catalyzed by ribulose 1,5-bisphosphate carboxylase/oxygenase (rubisco).

 

 

  1. Photosynthetic carbohydrate synthesis

Page: 775

Draw the structure of 3-phosphoglycerate.  Circle the atom(s) that would be labeled first in plants grown in CO2 labeled with radioactive carbon.

 

 

  1. Photosynthetic carbohydrate synthesis

Page: 779

Show the reaction in which 3-phosphoglycerate is converted into glyceraldehyde 3-phosphate.  Show all required cofactors, and circle the carbon atom(s) in glyceraldehyde 3-phosphate that is (are) derived from CO2 during the photosynthetic fixation of CO2.

 

 

 

  1. Photosynthetic carbohydrate synthesis

Page: 781

Diagram the reaction catalyzed by transketolase when fructose 6-phosphate and glyceraldehyde 3-phosphate are the substrates.

 

 

  1. Photosynthetic carbohydrate synthesis

Page: 782

Explain why both ATP and NADPH are required for the operation of the Calvin cycle, and why these two reactants are required in different amounts.

 

 

  1. Photosynthetic carbohydrate synthesis

Page: 784

How does glyceraldehyde 3-phosphate formed in the chloroplast stroma by the Calvin cycle reactions enter the cytosol?

  1. Photosynthetic carbohydrate synthesis

Pages: 784-785

Describe how thioredoxin participates in the regulation of several chloroplast enzymes by light.

 

 

  1. Photorespiration and the C4 and CAM pathways

Pages: 786

Explain why photorespiration is necessary for plant cells carrying out photosynthesis.

 

 

  1. Photorespiration and the C4 and CAM pathways

Pages: 786-788

Describe the oxygenase activity of ribulose 1,5-bisphosphate carboxylase/oxygenase (rubisco) and explain why this reaction is undesirable from the point of view of a plant.

 

 

  1. Photorespiration and the C4 and CAM pathways

Page: 787  Difficulty: 1

Describe the reaction sequence by which 2-phosphoglycolate (produced when O2 replaces CO2 as substrate for rubisco) is converted to serine.  Name each enzyme and any cofactors required and indicate the subcellular compartment in which the reaction takes place.

 

 

  1. Photorespiration and the C4 and CAM pathways

Page: 790  Difficulty: 1

CAM plants, such as cactus and pineapple, are native to very hot and dry environments.  Briefly describe the biochemical events that allow CAM plants to minimize water loss by closing their stroma during daylight hours.

 

  1. Biosynthesis of starch and sucrose

Pages: 791-793

Diagram the pathway by which sucrose is synthesized from glucose 6-phosphate; indicate how any required cofactors are involved.

 

 

  1. Biosynthesis of starch and sucrose

Pages: 791-792

Explain the utility to plants in using sucrose as the transport form of carbon.

 

 

  1. Biosynthesis of starch and sucrose

Pages: 791-792

Explain how starch synthase, in contrast to glycogen synthase in animals, can lengthen starch molecules from the reducing end of the polysaccharide chain.

 

 

  1. Biosynthesis of starch and sucrose

Page: 793

Describe briefly how the allosteric effector fructose 2,6-bisphosphate (F2,6BP) regulates starch and sucrose synthesis.

 

 

  1. Biosynthesis of starch and sucrose

Page: 793

Describe the role of fructose 2,6-bisphosphate in the regulation of sucrose biosynthesis in plant cells.

 

 

  1. Integration of carbohydrate metabolism in the plant cell

Page: 798 

Describe how plants and some microorganisms can, unlike animals, convert acetyl-CoA derived from fatty acids into glucose or sucrose.

 

 

  1. Integration of carbohydrate metabolism in the plant cell

Page:  799

Describe the interconversions between the triose-, pentose- and hexose-phosphate pools in the plant cell.

 

 

Chapter 21   Lipid Biosynthesis

 

 

 

Multiple Choice Questions

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 805-807    

Which of the following is not required in the synthesis of fatty acids?

 

  1. Acetyl-CoA
  2. Biotin
  3. HCO3(CO2)
  4. Malonyl-CoA
  5. NADH

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 805-807    

Which of the following is not true of the reaction producing malonyl-CoA during fatty acid synthesis?

 

  1. It is stimulated by citrate.
  2. It requires acyl carrier protein (ACP).
  3. It requires CO2(or bicarbonate).
  4. One mole of ATP is converted to ADP + Pi for each malonyl-CoA synthesized.
  5. The cofactor is biotin.

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 806-808                

If malonyl-CoA is synthesized from 14CO2 and unlabeled acetyl-CoA, and the labeled malonate is then used for fatty acid synthesis, the final product (fatty acid) will have radioactive carbon in:

 

  1. every C.
  2. every even-numbered C-atom.
  3. every odd-numbered C-atom.
  4. no part of the molecule.
  5. only the omega-carbon atom (farthest carbon from C-1).

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 808 

Which one of the following statements best applies to synthesis of fatty acids in E. coli extracts?

 

  1. Acyl intermediates are thioesters of a low molecular weight protein called acyl carrier protein.
  2. CO2or HCO3 is essential.
  3. Reducing equivalents are provided by NADPH
  4. The ultimate source of all the carbon atoms in the fatty acid product is acetyl-CoA.
  5. All of the above are true.

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 811-812    

In comparing fatty acid biosynthesis with b oxidation of fatty acids, which of the following statements is incorrect?

 

  1. A thioester derivative of crotonic acid (trans-2-butenoic acid) is an intermediate in the synthetic path, but not in the degradative path.
  2. A thioester derivative of D-b-hydroxybutyrate is an intermediate in the synthetic path, not in the degradative path.
  3. Fatty acid biosynthesis uses NADPH exclusively, whereas b oxidation uses NAD+
  4. Fatty acid degradation is catalyzed by cytosolic enzymes; fatty acid synthesis by mitochondrial enzymes.
  5. The condensation of two moles of acetyl-CoA in the presence of a crude extract is more rapid in bicarbonate buffer than in phosphate buffer at the same pH; the cleavage of acetoacetyl-CoA proceeds equally well in either buffer.

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 812 

Which of the following is not true of the fatty acid synthase and the fatty acid b-oxidation systems?

 

  1. A derivative of the vitamin pantothenic acid is involved.
  2. Acyl-CoA derivatives are intermediates.
  3. Double bonds are oxidized or reduced by pyridine nucleotide coenzymes.
  4. The processes occur in different cellular compartments.
  5. The processes occur in the mitochondrial matrix.

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 812-814    

The rate-limiting step in fatty acid synthesis is:

 

  1. condensation of acetyl-CoA and malonyl-CoA.
  2. formation of acetyl-CoA from acetate.
  3. formation of malonyl-CoA from malonate and coenzyme A.
  4. the reaction catalyzed by acetyl-CoA carboxylase.
  5. the reduction of the acetoacetyl group to a b-hydroxybutyryl group.

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 814-815    

Which of the following is not true of the fatty acid elongation system of vertebrate cells?

 

  1. It involves the same four-step sequence seen in the fatty acid synthase complex.
  2. It is located in the smooth endoplasmic reticulum.
  3. It produces stearoyl-CoA by the extension of palmitoyl-CoA.
  4. It uses malonyl-CoA as a substrate.
  5. The immediate precursor of the added carbons is acetyl-CoA.

 

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 815 

Which of these can be synthesized by plants but not by humans?

 

  1. Linoleate [18:2(D9,12)]
  2. Palmitate (16:0)
  3. Phosphatidylcholine
  4. Pyruvate
  5. Stearate (18:0)

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 815             

The enzyme system for adding double bonds to saturated fatty acids requires all of the following except:

 

  1. a mixed-function oxidase.
  2. cytochrome b5.
  3. molecular oxygen (O2).

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 817-818

Which of these statements about eicosanoid synthesis is true?

 

  1. An early step in the path to thromboxanes is blocked by ibuprofen.
  2. Arachidonate is derived mainly by hydrolysis of triacylglycerols.
  3. Aspirin acts by blocking the synthesis of arachidonate.
  4. Plants can synthesize leukotrienes, but humans cannot.
  5. Thromboxanes are produced from arachidonate via the “linear” path.

 

  1. Biosynthesis of triacylglycerols

Page: 820 

The biosynthesis of triacylglycerols from acetate occurs mainly in:

 

  1. animals but not in plants.
  2. humans after ingestion of excess carbohydrate.
  3. humans with low carbohydrate intake.
  4. plants but not in animals.
  5. none of the above.

 

 

  1. Biosynthesis of triacylglycerols

Pages: 820-821    

The synthesis of both glycerophospholipids and triacylglycerols involves:

 

  1. CDP-choline.
  2. CDP-diacylglycerol.
  3. phosphatidate phosphatase.
  4. phosphatidic acid.

 

  1. Biosynthesis of triacylglycerols

Pages: 821-822    

Which of these statements about triacylglycerol synthesis is correct?

 

  1. Humans can store more energy in glycogen than in triacylglycerols.
  2. Insulin stimulates conversion of dietary carbohydrate into triacylglycerols.
  3. It is not a hormone-sensitive process.
  4. Mammals are unable to convert carbohydrates into triacylglycerols.
  5. Phosphatidate is not on the pathway of triacylglycerol synthesis.

 

  1. Biosynthesis of membrane phospholipids

Pages: 824-829    

A strategy that is not employed in the synthesis of phospholipids is:

 

  1. condensation of CDP-alcohol with diacylglycerol.
  2. condensation of CDP-diacylglycerol with alcohol.
  3. condensation of CDP-diacylglycerol with CDP-alcohol.
  4. exchange of free alcohol with head group alcohol of phospholipid.
  5. remodeling of head group alcohols by chemical modification

 

  1. Biosynthesis of membrane phospholipids

Pages: 826-827

All glycerol-containing phospholipids are synthesized from:

 

  1. cardiolipin
  2. phosphatidic acid.

 

  1. Biosynthesis of membrane phospholipids

Pages: 827-828    

In E. coli the synthesis of phosphatidylethanolamine directly involves:

 

  1. acyl carrier protein.
  2. CDP-choline.

 

  1. Biosynthesis of membrane phospholipids

Page: 828 

In the synthesis of phosphatidylcholine from phosphatidylethanolamine, the methyl group donor is:

 

  1. a tetrahydrofolate derivative.
  2. S-adenosylmethionine (adoMet).

 

  1. Biosynthesis of membrane phospholipids

Page: 829

Palmitoyl-CoA, , is a direct precursor of:

 

  1. malonyl-CoA.
  2. mevalonate

 

  1. Biosynthesis of membrane phospholipids

Page: 829

CDP-diglyceride is not involved in the biosynthesis of:

 

  1. phosphatidylethanolamine

 

  1. Biosynthesis of membrane phospholipids

Page: 831

Which of the following is true of sphingolipid synthesis?

 

  1. All of the carbon atoms of palmitate and serine are incorporated into sphingosine.
  2. CDP-sphingosine is the activated intermediate.
  3. CO2is produced during the synthesis of ceramide from palmitate and serine.
  4. Glucose 6-phosphate is the direct precursor of the glucose in cerebrosides.
  5. Phosphatidic acid is a key intermediate in the pathway.

 

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Pages: 831-835

Which of the following is not an intermediate in the synthesis of lanosterol from acetyl-CoA?

 

  1. Isopentenyl pyrophosphate
  2. Malonyl-CoA
  3. Mevalonate
  4. Squalene
  5. b-Hydroxy-b-methylglutaryl-CoA (HMG-CoA)

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Page: 833

Cholesterol is synthesized from:

 

  1. acetyl-CoA.
  2. lipoic acid.

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Pages: 834-835

A 30-carbon precursor of the steroid nucleus is:

 

  1. farnesyl pyrophosphate.
  2. geranyl pyrophosphate.
  3. isopentenyl pyrophosphate.

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Pages: 834-835

Which of these statements about cholesterol synthesis is true?

 

  1. Cholesterol is the only known natural product whose biosynthesis involves isoprene units.
  2. Only half of the carbon atoms of cholesterol are derived from acetate.
  3. Squalene synthesis from farnesyl pyrophosphate results in the release of two moles of PPifor each mole of squalene formed.
  4. The activated intermediates in the pathway are CDP-derivatives.
  5. The condensation of two five-carbon units to yield geranyl pyrophosphate occurs in a “head-to-head” fashion.

 

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Page: 836

Which of the following is derived from a sterol?

  1. Bile salts
  2. Gangliosides
  3. Geraniol
  4. Phosphatidylglycerol
  5. Prostaglandins

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Page: 838

Chylomicrons carry            in the              .

  1. triacylglycerols; cell
  2. triacylglycerols; blood
  3. cholesterols; blood
  4. fatty acids; blood
  5. fatty acids; cell

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Page: 838

Lipoprotein particles in human blood do not contain:

  1. an apolipoprotein B isoform
  2. cholesterol
  3. cholesteryl esters
  4. lecithin
  5. triglycerides

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Pages: 841-842

Which of these statements about the regulation of cholesterol synthesis is not true?

  1. Cholesterol acquired in the diet has essentially no effect on the synthesis of cholesterol in the liver.
  2. Failure to regulate cholesterol synthesis predisposes humans to atherosclerosis.
  3. High intracellular cholesterol stimulates formation of cholesterol esters.
  4. Insulin stimulates HMG-CoA reductase.
  5. Some metabolite or derivative of cholesterol inhibits HMG-CoA reductase.

 

  1. Biosynthesis of cholesterol, steroids and isoprenoids

Pages: 844-845

Which of these compounds is not synthesized by a pathway that includes isoprene precursors?

 

  1. Natural rubber
  2. Plastoquinone
  3. Vitamin A
  4. Vitamin B12
  5. Vitamin K

 

 

Short Answer Questions

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 807 

In the conversion shown below (which occurs during fatty acid synthesis), if the compound on the left were labeled with 14C in its middle carbon (*), where would the label be in the compound on the right?  Circle the atoms that would be labeled.  (Not all reactants are shown.)

 

 

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 807 

The reaction sequence that leads to fatty acid synthesis includes (1) condensation, (2) first reduction reaction, (3) dehydration, and (4) second reduction.  Show the first reduction reaction, with any required cofactors.

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 808-809    

Fatty acid synthesis and fatty acid breakdown occur by similar pathways.  Describe, very briefly, four ways in which the synthetic and breakdown pathways differ.

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 808-809    

The synthesis of fatty acids and their breakdown by b oxidation occur by separate pathways.  Compare the two paths by filling in the blanks below.  (Some blanks may require more than one answer.)

 

Synthesis              b oxidation

——————————————————

Activating group                               _______________       ______________

Electron carrier coenzyme(s)            _______________       ______________

Basic units added or removed           _______________       ______________

Cellular location of process              _______________       ______________

 

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 810 

Show the structure of each intermediate in the conversion of b-hydroxybutyryl-ACP to butyryl-ACP by the fatty acid synthetase complex.  Show where cofactors participate.  In your first intermediate, circle the carbon atoms that are derived from malonyl-CoA.

 

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 811-813

Describe the mechanism for moving acetyl-CoA produced in the mitochondrial matrix into the cytosol for fatty acid synthesis.

 

  1. Biosynthesis of fatty acids and eicosanoids

Pages: 815-816

Explain briefly why we require fats in our diets.

 

 

  1. Biosynthesis of fatty acids and eicosanoids

Page: 818

Sketch the pathway from arachidonate to thromboxanes and explain how aspirin blocks the synthesis of thromboxanes.

 

 

  1. Biosynthesis of membrane phospholipids

Page: 825

Describe two basic strategies for activating precursors in the biosynthesis of phospholipids.

 

 

  1. Biosynthesis of membrane phospholipids

Pages: 826-828

Show the biosynthetic path(s) from phosphatidic acid to phosphatidylcholine.  You may use shorthand notation for phosphatidic acid, but name any cofactors required in the path and show where they are involved.

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Pages: 832

Describe briefly the four stages in the pathway from acetyl-CoA to lanosterol.

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Pages: 833

Show the reaction that limits the rate of cholesterol synthesis from acetate, indicating the role of any cofactors that participate.

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Page: 833

Show the pathway from acetyl-CoA to mevalonate, indicating the roles of any cofactors.

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Page: 833

Show the pathway from mevalonate to dimethylallyl pyrophosphate, indicating where any cofactors participate.

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Page: 833

The synthesis of cholesterol begins with the condensation of a four-carbon unit from _______________ with the two carbons of acetyl-CoA to form a six-carbon derivative.  Give its structure, and circle the atoms that originated in the acetyl-CoA.

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Page: 834

Describe the formation of farnesyl pyrophosphate from activated isoprenyl units.

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Page: 834

Show the structure of isopentenyl pyrophosphate and of dimethylallyl pyrophosphate.  Connect with a dotted line the two carbon atoms that will be joined when these two molecules condense to form the 10-carbon intermediate in cholesterol biosynthesis.

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Page: 834

Shown below is a molecule of squalene, which is composed of 6 isoprene units.  Draw lines to indicate the junctions between the six isoprene units.

 

 

 

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Page: 834

When a 10-carbon unit and a 5-carbon unit condense to a 15-carbon intermediate in the pathway to cholesterol, the mechanism of condensation is basically different from that of the condensation of two 15-carbon units to the 30-carbon compound squalene.  Describe the two condensations in enough chemical detail to illustrate the difference between them.  (You should show relevant structures.)

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Pages: 836-840

What are plasma lipoproteins?  What is their general role in mammalian metabolism?

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Pages: 840-841

Describe the process by which cholesterol esters in the bloodstream enter cells.

 

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Pages: 840-841

Describe (briefly) two classes of genetic defects in humans that could produce an elevated blood serum cholesterol level.

 

  1. Biosynthesis of cholesterol, steroids, and isoprenoids

Pages: 842-843     Difficulty: 1

The synthetic compound mevinolinic acid, also called lovastatin, is a potent competitive inhibitor of HMG-CoA reductase (hydroxymethylglutaryl-CoA reductase).  Predict and explain the effect of this drug on serum cholesterol levels in humans.

 

 

 

Chapter 22   Biosynthesis of Amino Acids, Nucleotides,

    and Related Molecules

 

 

 

Multiple Choice Questions

 

  1. Overview of nitrogen metabolism

Pages: 854-855    

Which of the following statements about the fixation of atmospheric nitrogen (N2) into NH3 by living cells is false?

 

  1. It involves the transfer of 8 electrons per mol of N2.
  2. It occurs in certain microorganisms, but not in humans.
  3. It requires a source of electrons, normally ferredoxin.
  4. It requires one ATP per mol of N2
  5. It requires two key protein components, each containing iron.

 

  1. Overview of nitrogen metabolism

Pages: 854-858

Which of the following enzymes is not involved in the assimilation of inorganic nitrogen into an organic molecule?

 

  1. Arginase
  2. Glutamate dehydrogenase
  3. Glutamate synthase
  4. Glutamine synthetase
  5. Nitrogenase

 

  1. Overview of nitrogen metabolism

Pages: 854-855

The enzymatic machinery to fix atmospheric N2 into NH4+ is:

 

  1. a means of producing ATP when excess N2 is available.
  2. composed of two key proteins, each containing iron.
  3. relatively stable when exposed to O2.
  4. specific to plant cells.
  5. unaffected by the supply of electrons.

 

  1. Biosynthesis of amino acids

Pages: 860-861

Erythrose 4-phosphate is a precursor of:

 

 

 

  1. Biosynthesis of amino acids

Pages: 860-861    

Nonessential amino acids:

 

  1. are amino acids other than those required for protein synthesis.
  2. are not utilized in mammalian proteins.
  3. are synthesized by plants and bacteria, but not by humans.
  4. can be synthesized in humans as well as in bacteria.
  5. may be substituted with other amino acids in proteins.

 

  1. Biosynthesis of amino acids

Page: 861             

An amino acid that does not derive its carbon skeleton, at least in part, from a-ketoglutarate is:

 

 

  1. Biosynthesis of amino acids

Page: 861

Glutamine, arginine, and proline:

 

  1. do not have a common precursor.
  2. may all be derived from a citric acid cycle intermediate.
  3. may all be derived from a Cori cycle intermediate.
  4. may all be derived from a glycolytic intermediate.
  5. may all be derived from a urea cycle intermediate.

 

  1. Biosynthesis of amino acids

Page: 862 

In which group are all the amino acids closely interrelated metabolically?

 

  1. Arginine, hydroxyproline, and histidine
  2. Arginine, tyrosine, and glutamate
  3. Glycine, valine, glutamine, and aspartate
  4. Ornithine, alanine, glycine, and valine
  5. Ornithine, proline, arginine, and glutamate

 

  1. Biosynthesis of amino acids

Page: 863 

If glucose labeled with 14C at C-1 were the starting material for amino acid biosynthesis, the product(s) that would be readily formed is (are):

 

  1. serine labeled at the carboxyl carbon.
  2. serine labeled at alpha carbon.
  3. serine labeled at the R-group carbon.
  4. all of the above.
  5. none of the above.

 

  1. Biosynthesis of amino acids

Page: 864             

An amino acid that does not derive its carbon skeleton, at least in part, from oxaloacetate is:

 

 

  1. Biosynthesis of amino acids

Page: 866 

Homoserine is:

 

  1. a precursor of both methionine and threonine.
  2. a precursor of serine.
  3. derived from homocysteine.
  4. derived from serine.
  5. derived from threonine.

 

  1. Biosynthesis of amino acids

Page: 866 

If a cell were unable to synthesize or obtain tetrahydrofolic acid (H4 folate), it would probably be deficient in the biosynthesis of:

 

 

  1. Biosynthesis of amino acids

Page: 869             

The nitrogen atom in the side chain of lysine is derived from which amino acid?

 

  1. aspartic acid.
  2. glutamic acid.

 

  1. Biosynthesis of amino acids

Page: 869             

The nitrogen atom in the indole ring of tryptophan is derived from which amino acid?

 

  1. aspartic acid.
  2. glutamic acid.

 

 

  1. Biosynthesis of amino acids

Page: 868 

An important intermediate in the biosynthetic pathway to aromatic amino acids is:

 

  1. benzoic acid.
  2. a-ketoglutarate.

 

  1. Molecules derived from amino acids

Page: 874 

d-Aminolevulinic acid is formed from succinyl-CoA and __________ and is an intermediate in the biosynthesis of _________.

 

  1. acetyl-CoA; long chain fatty acids
  2. glycine; heme
  3. serine; heme
  4. serine; sphingosine
  5. a-ketoglutarate; glutamate and proline

 

  1. Molecules derived from amino acids

Pages: 873-876

Bile pigments are:

 

  1. formed in the degradation of heme.
  2. generated by oxidation of sterols.
  3. responsible for light reception in the vertebrate eye.
  4. secreted from the pancreas
  5. the products of purine degradation.

 

  1. Molecules derived from amino acids

Pages: 876-877    

Glutathione is a(n):

 

  1. enzyme essential in the synthesis of glutamate.
  2. isomer of oxidized glutamic acid.
  3. methyl-group donor in many biosynthetic pathways.
  4. product of glutamate and methionine.
  5. tripeptide of glycine, glutamate, and cysteine.

 

  1. Molecules derived from amino acids

Page: 878

The plant hormone indole-3-acetate (auxin) is formed from:

 

 

  1. Molecules derived from amino acids

Page: 879

l-Dopa is an intermediate in the conversion of:

 

  1. phenylalanine to homogentisic acid.
  2. phenylalanine to tyrosine.
  3. tyrosine to epinephrine.
  4. tyrosine to phenylalanine.
  5. tyrosine to phenylpyruvate.

 

  1. Molecules derived from amino acids

Page: 879

The hormones epinephrine and norepinephrine are derived biosynthetically from:

 

 

  1. Biosynthesis and degradation of nucleotides

Page: 883 

One amino acid directly involved in the purine biosynthetic pathway is:

 

  1. tryptophan

 

  1. Biosynthesis and degradation of nucleotides

Page: 883

5-Phosphoribosyl-a-pyrophosphate (PRPP) is a synthetic precursor for all of the following except:

 

 

  1. Biosynthesis and degradation of nucleotides

Pages: 883-884    

Glutamine is a nitrogen donor in the synthesis of:

 

  1. inosinic acid (IMP).

 

  1. Biosynthesis and degradation of nucleotides

Pages: 883-884

De novo purine biosynthesis is distinguished from de novo pyrimidine biosynthesis by:

 

  1. condensation of the completed purine ring with ribose phosphate
  2. incorporation of CO2.
  3. inhibition by azaserine (a glutamine analog).
  4. participation of aspartate.
  5. participation of PRPP (phosphoribosyl pyrophosphate).

 

  1. Biosynthesis and degradation of nucleotides

Pages: 884, 886   

The ribosyl phosphate moiety needed for the synthesis of orotidylate, inosinate, and guanylate is provided most directly by:

 

  1. 5-phosphoribosyl 1-pyrophosphate.
  2. adenosine 5-phosphate.
  3. guanosine 5-phosphate.
  4. ribose 5-phosphate.
  5. ribulose 5-phosphate.

 

  1. Biosynthesis and degradation of nucleotides

Pages: 884, 886               

The synthesis of purine and pyrimidine nucleotides differ in that:

 

  1. ATP is required in the synthesis of purines but not in the synthesis of pyrimidines.
  2. purine biosynthesis starts with the formation of PRPP, whereas pyrimidines incorporate the PRPP near the end of the pathway.
  3. purine formation requires a THF derivative, whereas pyrimidine formation does not.
  4. pyrimidine biosynthesis is tightly regulated in the cell, whereas purine biosynthesis is not.
  5. pyrimidines go through many steps, adding a single carbon or nitrogen each time, whereas the basic skeleton for purines is formed by two main precursors.

 

  1. Biosynthesis and degradation of nucleotides

Page: 885 

Which one of the following statements is true of the biosynthetic pathway for purine nucleotides?

 

  1. CO2 does not participate in any of the steps in this pathway.
  2. Deoxyribonucleotides are formed from 5-phosphodeoxyribosyl 1-pyrophosphate.
  3. Inosinate is the purine nucleotide that is the precursor of both adenylate and guanylate.
  4. Orotic acid is an essential precursor for purine nucleotides.
  5. The amino acid valine is one of the precursors contributing to purine nucleotides.

 

  1. Biosynthesis and degradation of nucleotides

Page: 886

Orotic aciduria is an inherited metabolic disease in which orotic acid (orotate) accumulates in the tissues, blood, and urine. The metabolic pathway in which the enzyme defect occurs is:

 

  1. epinephrine synthesis.
  2. purine breakdown.
  3. purine synthesis.
  4. pyrimidine breakdown.
  5. pyrimidine synthesis.

 

  1. Biosynthesis and degradation of nucleotides

Page: 886 

Precursors for the biosynthesis of the pyrimidine ring system include:

 

  1. carbamoyl phosphate and aspartate.
  2. glutamate, NH3, and CO2.
  3. glycine and succinyl-CoA.
  4. glycine, glutamine, CO2, and aspartate.
  5. inosine and aspartate.

 

  1. Biosynthesis and degradation of nucleotides

Page: 886

The most direct precursors of the nitrogens of UMP are:

 

  1. aspartate and carbamoyl phosphate.
  2. glutamate and aspartate.
  3. glutamate and carbamoyl phosphate.
  4. glutamine and aspartate.
  5. glutamine and carbamoyl phosphate.

 

  1. Biosynthesis and degradation of nucleotides

Pages: 886-887    

CMP, UMP, and TMP all have ________________ as a common precursor.

 

  1. adenosine
  2. aspartate
  3. glutamine
  4. inosine
  5. S-adenosyl methionine

 

  1. Biosynthesis and degradation of nucleotides

Pages: 888-890

Which of the following is not true of the reaction catalyzed by ribonucleotide reductase?

 

  1. Glutathione is part of the path of electron transfer.
  2. It acts on nucleoside diphosphates.
  3. Its mechanism involves formation of a free radical.
  4. There is a separate enzyme for each nucleotide (ADP, CDP, GDP, UDP).
  5. Thioredoxin acts as an essential electron carrier.

 

  1. Biosynthesis and degradation of nucleotides

Page: 890

Which one of the following statements correctly describes the biosynthetic pathway for purine nucleotides?

 

  1. Purine deoxynucleotides are made by the same path as ribonucleotides, followed by reduction of the ribose moiety.
  2. The first enzyme in the path is aspartate transcarbamoylase (ATCase).
  3. The nitrogen in the purine base that is bonded to ribose in the nucleotide is derived originally from glycine.
  4. The pathway occurs only in plants and bacteria, not in animals.
  5. The purine rings are first synthesized, then condensed with ribose phosphate.

 

  1. Biosynthesis and degradation of nucleotides

Page: 891  Difficulty 3     

A cell that is unable to synthesize or obtain tetrahydrofolic acid (H4 folate) would probably be deficient in the biosynthesis of:

 

  1. thymidylate (TMP).

 

  1. Biosynthesis and degradation of nucleotides

Pages: 891-892    

An intermediate of purine degradation in humans is:

 

  1. NH4+.
  2. uric acid.

 

 

Short Answer Questions

 

  1. Overview of nitrogen metabolism

Pages: 854-858    

Trace the path of nitrogen from atmospheric N2 into glutamate.  Name the intermediates (no structures necessary) and enzymes, and show any coenzymes involved.

 

 

  1. Overview of nitrogen metabolism

Page: 857 

Give the overall reaction that results from the combined action of glutamate synthase and glutamine synthetase.

 

 

  1. Overview of nitrogen metabolism

Page: 857 

Give the equations for the two-step reaction sequence catalyzed by glutamine synthetase.

 

 

  1. Overview of nitrogen metabolism

Pages: 858-860    

Describe two types of regulation of the enzyme glutamine synthetase and explain why the regulation of this enzyme is so complex.

 

  1. Biosynthesis of amino acids

Page: 861 

Why is it necessary to have protein in our (human) diets?

 

 

  1. Biosynthesis of amino acids

Pages: 861-865    

Give the name and structure of the glycolytic or citric acid cycle intermediate that has the same carbon skeleton as  (a) alanine, (b) glutamate, (c) aspartate.

 

 

 

  1. Biosynthesis of amino acids

Page: 862 

Show the biosynthetic pathway for the conversion of a citric acid cycle intermediate into proline.  Indicate where any cofactors participate.

 

 

  1. Biosynthesis of amino acids

Page: 863 

Show the reaction catalyzed by glycine synthase, indicating the role of any cofactors that participate.

 

 

  1. Biosynthesis of amino acids

Page: 863 

An animal cell is capable of converting alanine into serine.  What is the shortest pathway using known enzymes by which this conversion could be accomplished?  Show intermediates and cofactors; no enzyme names are required.  (Hint: The first step is removal of the nitrogen by transamination.)

 

 

  1. Biosynthesis of amino acids

Page: 863 

Show the steps by which an intermediate of glycolysis can be converted into serine.

 

 

  1. Biosynthesis of amino acids

Page: 870

Show the two-step reaction catalyzed by tryptophan synthetase.

 

 

  1. Biosynthesis of amino acids

Pages: 861-869

In bacteria, the amino acids listed below can be derived directly or indirectly from serine, alanine, aspartate, glutamate, or chorismate.  Indicate below which of these “parent” compounds provides the carbon skeleton for each amino acid:

 

Parent compound

 

Asparagine        __________________

Tryptophan       __________________

Glycine             __________________

Methionine        __________________

Threonine          __________________

Cysteine            __________________

Proline               __________________

Isoleucine          __________________

Phenylalanine    __________________

 

  1. Biosynthesis of amino acids

Pages: 858, 885-886

Describe and contrast, with diagrams, concerted (cumulative) feedback regulation and sequential feedback inhibition.

 

 

  1. Molecules derived from amino acids

Page: 874 

Show the biosynthetic pathway from succinyl-CoA and glycine to porphobilinogen.

 

 

  1. Molecules derived from amino acids

Pages: 878-879    

Match the signaling molecule with its amino acid precursor (a given precursor may be used more than once or not at all

 

Signal Molecule           Amino Acid Precursor

(a) auxin                      (1) histidine

(b) epinephrine                        (2) glutamic acid

(c) g-amino butyrate     (3) tyrosine

(d) histamine                (4) tryptophan

(e) serotonin                (5) arginine

 

 

  1. Biosynthesis and degradation of nucleotides

Pages: 883-885    

Draw the structure of 5-AMP.  Indicate with arrows those carbon atoms donated by derivatives of tetrahydrofolate, and circle the atoms derived from glycine.

 

 

  1. Biosynthesis and degradation of nucleotides

Pages: 883-885    

Draw the structure of any purine nucleotide, name it correctly, circle the atom(s) derived from glycine.  Indicate with an arrow the atom(s) derived from glutamine’s amide group(s).

 

 

  1. Biosynthesis and degradation of nucleotides

Pages: 884-885    

Draw the structure of inosinic acid (IMP).  Indicate the source of each N in this structure.  What is the first “committed” step in the biosynthetic sequence that leads to IMP?  How is this step regulated?

 

 

  1. Biosynthesis and degradation of nucleotides

Page: 886 

Draw the structure of 5-UMP (uridylic acid).  Circle those carbon atoms donated by atoms derived from aspartate.  Draw the reaction (with structures) in which a nitrogenous base is converted to a nucleotide on the pathway to 5-UMP.

 

 

  1. Biosynthesis and degradation of nucleotides

Pages: 886, 891   

Draw the structure of deoxythymidylic acid (dTMP).  Indicate the source of each N and each C in the thymine ring, including its substituents.

 

 

  1. Biosynthesis and degradation of nucleotides

Page: 888 

Describe the pathway by which GMP is converted into GTP; show coenzymes that are involved and name the enzymes.

 

  1. Biosynthesis and degradation of nucleotides

Pages: 888-891    

Diagram the biosynthetic pathway from UMP to dTTP.  Use abbreviations (e.g., UMP), not complete structures, and indicate where any cofactors participate.

 

  1. Biosynthesis and degradation of nucleotides

Pages: 891, 895               

Show the reaction catalyzed by thymidylate synthase and explain with a simple diagram how the chemotherapeutic agents fluorouracil and methotrexate inhibit the synthesis of dTMP.

 

 

  1. Biosynthesis and degradation of nucleotides

Page: 894 

Azaserine is a structural analog of glutamine.  It is a competitive inhibitor of many enzymes that use glutamine as substrates.  Name (no structures necessary) three biosynthetic products, the synthesis of which you would expect to be inhibited by azaserine.  Do you think that eating azaserine would be immediately fatal?  Why or why not?

 

 

Chapter 23   Integration and Hormonal Regulation of

    Mammalian Metabolism

 

 

 

Multiple Choice Questions

 

  1. Hormones: diverse structures for diverse functions

Page: 904

The radioimmunossay (RIA) is based on competition of unlabeled and radiolabeled:

 

  1. antibodies for binding to a hormone.
  2. antibodies for binding to a receptor.
  3. hormone for binding to a receptor.
  4. hormone for binding to an antibody.
  5. receptor for binding to a hormone.

 

  1. Hormones: diverse structures for diverse functions

Page: 905

One distinction between peptide and steroid hormones is that peptide hormones:

 

  1. act through nonspecific receptors, whereas steroid hormones act through specific receptors.
  2. are generally water-insoluble, whereas steroid hormones are water soluble.
  3. are more stable than steroid hormones.
  4. bind to cell surface receptors, whereas steroid hormones bind to nuclear receptors.
  5. bind to their receptors with high affinity, whereas steroid hormones bind with low affinity.

 

  1. Hormones: diverse structures for diverse functions

Page: 907

Insulin is an example of a(n) ____________ hormone.

 

  1. catecholamine
  2. eicosanoid
  3. paracrine
  4. peptide
  5. steroid

 

  1. Hormones: diverse structures for diverse functions

Page: 907

The maturation of insulin from its precursor (preproinsulin) involves:

 

 

 

 

 

  1. Hormones: diverse structures for diverse functions

Page: 908

Epinephrine is an example of a(n) ____________ hormone.

 

  1. catecholamine
  2. eicosanoid
  3. paracrine
  4. peptide
  5. steroid

 

  1. Hormones: diverse structures for diverse functions

Page: 908

An example of an eicosanoid hormone is:

 

  1. retinoic acid.

 

  1. Hormones: diverse structures for diverse functions

Page: 908

An example of a steroid hormone is:

 

  1. retinoic acid.

 

  1. Hormones: diverse structures for diverse functions

Pages: 907-909

Some hormones are derived from amino acids; for example, catecholamines are derived from                 while NO is derived from            .

 

  1. tyrosine; arginine
  2. tryptophan; lysine
  3. tyrosine; histidine
  4. tryptophan; arginine
  5. histidine; lysine

 

  1. Hormones: diverse structures for diverse functions

Page: 910

The tropic hormones (such as thyrotropin, somatotropin, and luteinizing hormone) are produced and released by the:

 

  1. anterior pituitary.
  2. posterior pituitary.

 

  1. Hormones: diverse structures for diverse functions

Page: 910

The normal sequence of action of these components of the hormonal hierarchy is:

 

  1. adrenal cortex ® hypothalamus ® anterior pituitary
  2. anterior pituitary ® adrenal cortex ® hypothalamus
  3. anterior pituitary ® hypothalamus ® adrenal cortex
  4. hypothalamus ® adrenal cortex ® anterior pituitary
  5. hypothalamus ® anterior pituitary ® adrenal cortex

 

  1. Hormones: diverse structures for diverse functions

Page: 910

In its role in the hormonal hierarchy, the hypothalamus produces and releases:

 

  1. releasing factors.

 

  1. Tissue-specific metabolism: the division of labor

Pages: 912-916                

Which of the following statements about metabolism in the mammalian liver is false?

 

  1. Most plasma lipoproteins are synthesized in the liver.
  2. The enzymatic complement of liver tissue changes in response to changes in the diet.
  3. The liver synthesizes most of the urea produced in the body.
  4. The presence of glucose 6-phosphatase makes liver uniquely able to release glucose into the bloodstream.
  5. Under certain conditions, most of the functions of the liver can be performed by other organs.

 

  1. Tissue-specific metabolism: the division of labor

Page: 913 

Glucokinase:

 

  1. acts in the conversion of liver glycogen to glucose 1-phosphate.
  2. converts fructose-6-phosphate to glucose-6-phosphate
  3. converts glucose 6-phosphate to fructose 6-phosphate.
  4. is a hexokinase isozyme found in liver hepatocytes.
  5. is found in all mammalian tissues.

 

  1. Tissue-specific metabolism: the division of labor

Page: 918             

In skeletal muscle:

 

  1. amino acids are an essential fuel.
  2. at rest, fatty acids are the preferred fuel.
  3. large quantities of triacylglycerol are stored as fuel.
  4. phosphocreatine can substitute for ATP as the direct source of energy for muscle contraction.
  5. stored muscle glycogen can be converted to glucose and released to replenish blood glucose.
  6. Tissue-specific metabolism: the division of labor

Page: 918             

In skeletal muscle, phosphocreatine functions as:

 

  1. a reservoir of Pi for mitochondria.
  2. reservoir of high-energy of phosphate to replenish ATP.
  3. reservoir of amino acids for protein synthesis.
  4. an electron acceptor under anaerobic conditions.
  5. none of the above.

 

  1. Tissue-specific metabolism: the division of labor

Pages: 918-919

The Cori cycle is:

 

  1. the conversion of lactate to pyruvate in skeletal muscle to drive glycogen synthesis.
  2. the interconversion between glycogen and glucose l-phosphate.
  3. the production of lactate from glucose in peripheral tissues with the resynthesis of glucose from lactate in liver.
  4. the synthesis of alanine from pyruvate in skeletal muscle and the synthesis of pyruvate from alanine in liver.
  5. the synthesis of urea in liver and degradation of urea to carbon dioxide and ammonia by bacteria in the gut.

 

  1. Tissue-specific metabolism: the division of labor

Page: 920             

Which one of the following statements is true?

 

  1. The brain prefers glucose as an energy source, but can use ketone bodies.
  2. Muscle cannot use fatty acids as an energy source.
  3. In a well-fed human, about equal amounts of energy are stored as glycogen and as triacylglycerol.
  4. Fatty acids cannot be used as an energy source in humans because humans lack the enzymes of the glyoxylate cycle.
  5. Amino acids are a preferable energy source over fatty acids.

 

  1. Hormonal regulation of fuel metabolism

Pages: 922-923

When blood glucose is abnormally high, the pancreas releases:

 

 

 

  1. Hormonal regulation of fuel metabolism

Pages: 925-926

When blood glucose is abnormally low, the pancreas releases:

 

 

  1. Hormonal regulation of fuel metabolism

Pages: 922-923

An elevated insulin level in the blood:

 

  1. inhibits glucose uptake by the liver.
  2. inhibits glycogen synthesis in the liver and muscle.
  3. results from a below-normal blood glucose level.
  4. stimulates glycogen breakdown in liver.
  5. stimulates synthesis of fatty acids and triacylglycerols in the liver.

 

  1. Hormonal regulation of fuel metabolism

Pages: 926-927                

The largest energy store in a well-nourished human is:

 

  1. ATP in all tissues.
  2. blood glucose.
  3. liver glycogen.
  4. muscle glycogen.
  5. triacylglycerols in adipose tissue.

 

  1. Hormonal regulation of fuel metabolism

Pages: 928-929

Elevated epinephrine levels do not normally stimulate:

 

  1. fatty acid mobilization in adipose tissue.
  2. gluconeogenesis in liver.
  3. glycogen breakdown in muscle.
  4. glycogen synthesis in liver.
  5. glycolysis in muscle.

 

  1. Hormonal regulation of fuel metabolism

Pages: 928-929                

Epinephrine triggers an increased rate of glycolysis in muscle by:

 

  1. activation of hexokinase.
  2. activation of phosphofructokinase-1.
  3. conversion of glycogen phosphorylase a to glycogen phosphorylase b.
  4. inhibition of the Cori Cycle
  5. the Pasteur effect.

 

 

  1. Obesity and the regulation of body mass

Pages: 930-931

Long-term maintenance of body weight is regulated by the hormone:

 

 

  1. Obesity and the regulation of body mass

Pages: 931-933

Among its numerous metabolic effects, the protein leptin:

 

  1. decreases the production of glucocorticoids.
  2. inactivates the enzyme 5’-AMP-activated protein kinase (AMPK).
  3. increases the production of sex hormones.
  4. makes muscle and liver cells more sensitive to insulin.
  5. raises the production of thyroid hormone.

 

  1. Obesity and the regulation of body mass

Page: 932

The hormone leptin                        appetite; insulin           appetite.

 

  1. increases; increases
  2. increases; decreases
  3. decreases; increases
  4. decreases; decreases
  5. no effect; no effect

 

  1. Obesity and the regulation of body mass

Page: 914

The peptide hormone adiponectin, produced in adipose tissue, circulates in the blood and:

 

  1. enhances fatty acid synthesis in liver cells.
  2. increases the rate of b-oxidation of fatty acids in muscle cells.
  3. inhibits glucose uptake and catabolism in muscle and liver cells.
  4. reduces the transport of fatty acids into muscle cells.
  5. stimulates gluconeogenesis in liver cells.

 

 

 

Short Answer Questions

 

  1. Hormones: diverse structures for diverse functions

Page: 902 

What is a major problem in isolating a new hormone once a bioassay has been developed?

 

 

  1. Hormones: diverse structures for diverse functions

Page: 906 

Name three general classes of hormones and give an example of each.

 

 

  1. Hormones: diverse structures for diverse functions

Page: 906 

Some hormones trigger very rapid responses, whereas for others the response takes much longer to develop.  What generalization about the mechanisms of action of these two types of hormones can explain the differences in response times?

 

 

 

  1. Hormones: diverse structures for diverse functions

Page: 908 

What distinguishes eicosanoids from other potent biological signaling molecules such as epinephrine?

 

  1. Hormones: diverse structures for diverse functions

Page: 908 

Which class of hormones acts via nuclear receptors?  Give an example of this type of hormone and briefly describe its mode of action.

 

  1. Hormones: diverse structures for diverse functions

Page: 910 

How do hormonal cascades result in large amplification of the original signal?

 

  1. Tissue-specific metabolism: the division of labor

Page: 914 

Describe five possible fates for glucose 6-phosphate in the liver.

 

 

 

  1. Tissue-specific metabolism: the division of labor

Pages: 914-915    

Describe five possible fates of amino acids arriving in the liver after intestinal uptake.

 

 

  1. Tissue-specific metabolism: the division of labor

Pagse: 915-916    

Describe five possible fates for fatty acids in the liver.

 

 

  1. Hormonal regulation of fuel metabolism

Pages: 922-929    

Compare in general terms the effects of epinephrine, glucagon, and insulin on glucose metabolism.

 

 

  1. Hormonal regulation of fuel metabolism

Page: 929-930      

Suppose you are responsible for formulating the diet for a 4-year-old boy with diabetes.  How do you decide what kind and amount of carbohydrate and protein to include in the diet?  What compounds would you monitor in blood and urine and why?

 

 

  1. Obesity and the regulation of body mass

Pages: 930-933

What is leptin?  How does it function in the long-term maintenance of body mass?

 

 

  1. Obesity and the regulation of body mass
Page: 933

Describe the signaling cascade initiated by leptin binding to its receptor.

 

 

Chapter 24   Genes and Chromosomes

 

 

Multiple Choice Questions

 

  1. Chromosomal elements

Pages: 947-948

The most precise modern definition of a gene is a segment of genetic material that:

 

  1. codes for one polypeptide.
  2. codes for one polypeptide or RNA product.
  3. determines one phenotype.
  4. determines one trait.
  5. that codes for one protein.

 

  1. Chromosomal elements

Page: 949

The DNA in a bacterial (prokaryotic) chromosome is best described as:

 

  1. a single circular double-helical molecule.
  2. a single linear double-helical molecule.
  3. a single linear single-stranded molecule.
  4. multiple linear double-helical molecules.
  5. multiple linear single-stranded molecules.

 

  1. Chromosomal elements

Page: 949

Bacterial plasmids:

 

  1. are always covalently joined to the bacterial chromosome.
  2. are composed of RNA.
  3. are never circular.
  4. cannot replicate when cells divide.
  5. often encode proteins not normally essential to the bacterium’s survival.

 

  1. Chromosomal elements

Pages: 948-951

Which of these statements about nucleic acids is false?

 

  1. Mitochondria and chloroplasts contain DNA.
  2. Plasmids are genes that encode plasma proteins in mammals.
  3. The chromosome of coli is a closed-circular, double-helical DNA.
  4. The DNA of viruses is usually much longer than the viral particle itself.
  5. The genome of many plant viruses is RNA.

 

 

 

 

  1. Chromosomal elements

Pages: 948-951

Functional DNA is not found in:

 

  1. bacterial nucleoids.

 

  1. Chromosomal elements

Pages: 948-951

The DNA in a eukaryotic chromosome is best described as:

 

  1. a single circular double-helical molecule.
  2. a single linear double-helical molecule.
  3. a single linear single-stranded molecule.
  4. multiple linear double-helical molecules.
  5. multiple linear single-stranded molecules.

 

  1. Chromosomal elements

Page: 952

Introns:

 

  1. are frequently present in prokaryotic genes but are rare in eukaryotic genes.
  2. are spliced out before transcription.
  3. are translated but not transcribed.
  4. can occur many times within a single gene.
  5. encode unusual amino acids in proteins.

 

  1. Chromosomal elements

Page: 952

Approximately what fraction of the human genome is tranaposable elements?

 

  1. 5%
  2. 5%
  3. 10%
  4. 45%
  5. 80%

 

  1. Chromosomal elements

Page: 953

The chromosomal region that is the point of attachment of the mitotic spindle is the:

 

 

  1. DNA supercoiling

Page: 953

DNA in a closed-circular, double-stranded molecule with no net bending of the DNA axis on itself is:

 

  1. a left-handed helix.
  2. a mixed right- and left-handed helix.

 

  1. DNA supercoiling

Pages: 954-956                

It is correct to say that DNA supercoiling cannot:

 

  1. be induced by strand separation.
  2. be induced by underwinding of the double helix.
  3. form if there is Z-DNA structure present.
  4. occur if a closed circular double-stranded DNA molecule has a nick.
  5. result in compaction of the DNA structure.

 

  1. DNA supercoiling

Pages: 956-957

The linking number (Lk) of a closed-circular, double-stranded DNA molecule is changed by:

 

  1. breaking a strand, then rejoining it.
  2. breaking a strand, unwinding or rewinding the DNA, then rejoining it.
  3. breaking all hydrogen bonds in the DNA.
  4. supercoiling without the breaking of any phosphodiester bonds.
  5. underwinding without the breaking of any phosphodiester bonds.

 

  1. DNA supercoiling

Pages: 956-957

For a closed-circular DNA molecule of 10,000 base pairs in the fully relaxed form, the linking number (Lk) is about:

 

  1. 10,000.
  2. 5.

 

  1. DNA supercoiling

Pages: 956-957

If the structure of a fully relaxed, closed-circular DNA molecule is changed so that the specific linking difference (s) is –0.05, the number of:

 

  1. bases is decreased by 5%.
  2. bases is increased by 5%.
  3. helical turns is decreased by 5%.
  4. helical turns is increased by 5%.
  5. helical turns is unchanged.

 

  1. DNA supercoiling

Pages: 958-959                

Topoisomerases can:

 

  1. change the linking number (Lk) of a DNA molecule.
  2. change the number of base pairs in a DNA molecule.
  3. change the number of nucleotides in a DNA molecule.
  4. convert D isomers of nucleotides to L isomers.
  5. interconvert DNA and RNA.

 

  1. DNA supercoiling

Pages: 958-960                

Topoisomerases:

 

  1. always change the linking number in increments of 1.
  2. can act on single-stranded DNA circles.
  3. change the degree of supercoiling of a DNA molecule but not its linking number of DNA.
  4. occur in bacteria, but not in eukaryotes.
  5. require energy from ATP.

 

  1. DNA supercoiling

Pages: 961-962                

Plectonemic supercoils in a negatively supercoiled DNA molecule:

 

  1. are always left-handed.
  2. are always right-handed.
  3. are balanced by solenoidal supercoils
  4. can be either right- or left-handed.
  5. never occur.

 

  1. The structure of chromosomes

Page: 963

Histones are _______ that are usually associated with _________.

 

  1. acidic proteins; DNA
  2. acidic proteins; RNA
  3. basic proteins; DNA
  4. basic proteins; RNA
  5. coenzymes derived from histidine; enzymes

 

  1. The structure of chromosomes

Pages: 964-965

The fundamental repeating unit of organization in a eukaryotic chromosome is:

 

  1. the centrosome.
  2. the lysosome.
  3. the microsome.
  4. the nucleosome.
  5. the polysome.

 

  1. The structure of chromosomes

Pages: 964-965

Which of the following contributes to the structure of nucleosomes?

 

  1. Plectonemic supercoiled DNA
  2. Relaxed closed-circular DNA
  3. Solenoidal supercoiled DNA
  4. Spacer DNA
  5. Z (left-handed) DNA

 

  1. The structure of chromosomes

Pages: 964-965                

Nucleosomes:

 

  1. are important features of chromosome organization in eukaryotes and bacteria.
  2. are composed of proteins rich in acidic amino acids, such as Asp and Glu.
  3. are composed of protein and RNA.
  4. bind DNA and alter its supercoiling.
  5. occur in chromatin at irregular intervals along the DNA molecule.

 

  1. The structure of chromosomes

Pages:  966-968                           

A condensed eukaryotic chromosome is known to be associated with all of the following proteins, except for:

 

  1. Core histones H2A, H2B, H3, and H4.
  2. Histone H1
  3. SMC proteins
  4. Topoisomerase I
  5. Topoisomerase II

 

  1. The structure of chromosomes

Pages:  968-969               

The SMC proteins (for structural maintenance of chromosomes) include cohesins and condensins, and are known to have all of the following properties except:

 

  1. A complete ATP binding site.
  2. A hinge region
  3. Topoisomerase activity to produce positive supercoils
  4. The ability to condense DNA
  5. Two coiled-coil domains

 

  1. The structure of chromosomes

Pages: 968-970

Bacterial chromosomes:

 

  1. are highly compacted into structures called nucleoids.
  2. are seen in electron microscopy as “beads on a string”.
  3. are surrounded by a nuclear membrane.
  4. contain large numbers of nucleosomes.
  5. when fully extended are as long as the bacterial cell.

 

 

Short Answer Questions

 

  1. Chromosomal elements

Page: 949

Describe the structure and function of a typical bacterial plasmid.

 

 

  1. Chromosomal elements

Page: 950

The genome of the bacterium E. coli is 4,639,675 bp long and consists of 4,435 genes; the human genome is 3,070,128,600 bp long and consists of roughly 29,000 genes.  Calculate the average gene size in each organism and provide an explanation for the difference.

 

  1. Chromosomal elements

Pages: 949-951

Describe a current hypothesis to explain the presence of functional DNA in mitochondria and chloroplasts.

 

 

  1. Chromosomal elements

Page: 952 

What are introns?

 

 

  1. Chromosomal elements

Page: 953

What is satellite DNA?

 

 

 

  1. DNA supercoiling

Page: 954 

Describe two functions of DNA supercoiling.

 

 

  1. DNA supercoiling

Page: 954 

Define, in the context of DNA structure, “topological bond.”

 

 

  1. DNA supercoiling

Pages: 956-957    

Define “specific linking difference” (s), also called superhelical density.

 

 

  1. DNA supercoiling

Pages: 956-958, 964-965

Indicate whether the following statements are true (T) or false (F).

___ The linking number (Lk) of a closed-circular DNA molecule can be changed only by

breaking one or both strands.

___ DNA of all organisms is overwound (i.e., positively supercoiled).

___ Topoisomerase I relaxes DNA that is highly negatively supercoiled.

___ In a nucleosome, eukaryotic DNA is wrapped around histone proteins.

 

 

  1. DNA supercoiling

Pages: 956-961, 964-965

Calculate values for the following topological properties of a closed-circular DNA molecule containing 2,000 base pairs (for simplicity, assume there are 10 base pairs per turn in the relaxed DNA).

  • The linking number when the DNA is relaxed
  • The linking number when the DNA has been underwound by 10 enzymatic turnovers of DNA gyrase (+ATP)
  • The linking number when the DNA has been underwound by binding five nucleosomes followed by complete relaxation by a eukaryotic topoisomerase
  • The superhelical density of the DNA molecule in (b)
  • The superhelical density of the DNA molecule in (c)

 

  1. DNA supercoiling

Page: 957  Difficulty: 1

Define, in the context of DNA structure, “topoisomers.”

 

 

  1. DNA supercoiling

Pages: 958-961

Define topoisomerase, and explain the difference between type I and type II topoisomerases.

 

  1. DNA supercoiling

Pages: 958-961    

The DNA of virtually every cell is underwound (i.e., negatively supercoiled) relative to B-form DNA.  In bacteria, an enzyme called (a) ____________ introduces negative supertwists into DNA using (b) ____________ as a source of energy.  This enzyme is classified as a type (c) ____________, which affects the linking number in steps of (d) ___________.  The usual substrate for this enzyme within an E. coli cell is the bacterial chromosome.  This circular DNA molecule of 4,700,000 base pairs has a linking number of approximately (e) ____________ when it is closed and relaxed.  This enzyme would (f) ____________ (decrease/increase/not change) this linking number when acting upon this DNA molecule in the presence of the above energy source.

 

 

  1. DNA supercoiling

Pages: 960-961

Explain how inhibitors of topoisomerase would inhibit the growth of tumors; would these drugs be expected to inhibit the growth of normal cells as well?.

 

 

  1. DNA supercoiling

Pages: 961-962

Explain the difference between plectonemic and solenoidal supercoiling of DNA; use diagrams to help in your explanation.

 

 

  1. The structure of chromosomes

Page: 939 

Briefly describe the changes in eukaryotic chromosome structure during the cell cycle.

 

  1. The structure of chromosomes

Pages: 963-964    

What are histones and what is their principal role in chromatin structure?

 

 

  1. The structure of chromosomes

Pages: 964-965    

Describe the composition and structure of a nucleosome.

 

 

 

  1. The structure of chromosomes

Pages: 966-968    

The overall compaction of a eukaryotic chromosome is greater than ____________ -fold.  The first level is nucleosome formation, which compacts about _________ -fold.  Next is the 30 nm fiber, which compacts about ________ -fold overall.  Higher order folding involves association of the DNA with a nuclear ______________________ , which contains large amounts of ________________ and ___________________ .

 

 

  1. The structure of chromosomes

Pages: 968-969    

SMC proteins facilitate the structural maintenance of chromosomes;  describe the roles of the two main classes.

 

 

Chapter 25   DNA Metabolism

 

 

 

Multiple Choice Questions

 

DNA replication

Page: 977

The Meselson-Stahl experiment established that:

 

  1. DNA polymerase has a crucial role in DNA synthesis.
  2. DNA synthesis in coli proceeds by a conservative mechanism.
  3. DNA synthesis in coli proceeds by a semiconservative mechanism.
  4. DNA synthesis requires dATP, dCTP, dGTP, and dTTP.
  5. newly synthesized DNA in coli has a different base composition than the preexisting DNA.

 

DNA replication

Page: 978

When a DNA molecule is described as replicating bidirectionally, that means that it has two:

 

  1. independently replicating segment.
  2. replication forks.
  3. termination points.

 

DNA replication

Page: 979

An Okazaki fragment is a:

 

  1. fragment of DNA resulting from endonuclease action.
  2. fragment of RNA that is a subunit of the 30S ribosome.
  3. piece of DNA that is synthesized in the 3 ® 5
  4. segment of DNA that is an intermediate in the synthesis of the lagging strand.
  5. segment of mRNA synthesized by RNA polymerase.

 

DNA replication

Pages: 979-984                

Which one of the following statements about enzymes that interact with DNA is true?

 

  1. coli DNA polymerase I is unusual in that it possesses only a 5 ® 3 exonucleolytic activity.
  2. Endonucleases degrade circular but not linear DNA molecules.
  3. Exonucleases degrade DNA at a free end.
  4. Many DNA polymerases have a proofreading 5 ® 3
  5. Primases synthesize a short stretch of DNA to prime further synthesis.

 

 

 

 

 

DNA replication

Page: 982

  1. coli DNA polymerase III:

 

  1. can initiate replication without a primer.
  2. is efficient at nick translation.
  3. is the principal DNA polymerase in chromosomal DNA replication.
  4. represents over 90% of the DNA polymerase activity in coli cells.
  5. requires a free 5-hydroxyl group as a primer.

 

DNA replication

Pages: 981-982                

The proofreading function of DNA polymerase involves all of the following except:

 

  1. a 3 ® 5
  2. base pairing.
  3. detection of mismatched base pairs.
  4. phosphodiester bond hydrolysis.
  5. reversal of the polymerization reaction.

 

DNA replication

Page: 982             

The 5 ® 3 exonuclease activity of E. coli DNA polymerase I is involved in:

 

  1. formation of a nick at the DNA replication origin.
  2. formation of Okazaki fragments.
  3. proofreading of the replication process.
  4. removal of RNA primers by nick translation.
  5. sealing of nicks by ligase action.

 

DNA replication

Pages: 982-983                

Prokaryotic DNA polymerase III:

 

  1. contains a 5 ® 3 proofreading activity to improve the fidelity of replication.
  2. does not require a primer molecule to initiate replication.
  3. has a b subunit that acts as a circular clamp to improve the processivity of DNA synthesis.
  4. synthesizes DNA in the 3 ® 5
  5. synthesizes only the leading strand; DNA polymerase I synthesizes the lagging strand.

 

DNA replication

Page: 986             

Which of the following is not required for initiation of DNA replication in E. coli?

 

  1. DnaB (helicase)
  2. DnaG (primase)
  3. Dam methylase
  4. DNA ligase
  5. none of the above

 

DNA replication

Page: 988             

At replication forks in E. coli:

 

  1. DNA helicases make endonucleolytic cuts in DNA.
  2. DNA primers are degraded by exonucleases.
  3. DNA topoisomerases make endonucleolytic cuts in DNA.
  4. RNA primers are removed by primase.
  5. RNA primers are synthesized by primase.

 

DNA replication

Pages: 990-992    

In contrast to bacteria, eukaryotic chromosomes need multiple DNA replication origins because:

 

  1. eukaryotic chromosomes cannot usually replicate bidirectionally.
  2. eukaryotic genomes are not usually circular, like the bacterial chromosome is.
  3. the processivity of the eukaryotic DNA polymerase is much less than the bacterial enzyme.
  4. their replication rate is much slower, and it would take too long with only a single origin per chromosome.
  5. they have a variety of DNA polymerases for different purposes, and need a corresponding variety of replication origins.

 

DNA replication

Page: 992 

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the b-subunit of bacterial DNA polymerase III in that it:

 

  1. facilitates replication of telomeres.
  2. forms a circular sliding clamp to increase the processivity of replication.
  3. has a 3 ® 5 proofreading activity.
  4. increases the speed but not the processivity of the replication complex.
  5. participates in DNA repair.

 

DNA repair

Page: 993             

The Ames test is used to:

 

  1. detect bacterial viruses.
  2. determine the rate of DNA replication.
  3. examine the potency of antibiotics.
  4. measure the mutagenic effects of various chemical compounds.
  5. quantify the damaging effects of UV light on DNA molecules.

 

 

DNA repair

      Pages: 993-994

In a mammalian cell, DNA repair systems:

 

  1. are extraordinarily efficient energetically.
  2. are generally absent, except in egg and sperm cells.
  3. can repair deletions, but not mismatches.
  4. can repair most types of lesions except those caused by UV light.
  5. normally repair more than 99% of the DNA lesions that occur.

 

DNA repair

      Pages: 993-995

Which of these enzymes is not directly involved in methyl-directed mismatch repair in E. coli?

 

  1. DNA glycosylase
  2. DNA helicase II
  3. DNA ligase
  4. DNA polymerase III
  5. Exonuclease I

 

DNA repair

Page: 994

The role of the Dam methylase is to:

 

  1. add a methyl group to uracil, converting it to thymine.
  2. modify the template strand for recognition by repair systems.
  3. remove a methyl group from thymine.
  4. remove a mismatched nucleotide from the template strand.
  5. replace a mismatched nucleotide with the correct one.

 

DNA repair

Pages: 994-997

When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-directed repair system:

 

  1. cannot distinguish the template strand from the newly replicated strand.
  2. changes both the template strand and the newly replicated strand.
  3. corrects the DNA strand that is methylated.
  4. corrects the mismatch by changing the newly replicated strand.
  5. corrects the mismatch by changing the template strand.

 

DNA repair

Pages: 996-997

In base-excision repair, the first enzyme to act is:

 

  1. AP endonuclease.
  2. Dam methylase.
  3. DNA glycosylase.
  4. DNA ligase.
  5. DNA polymerase.

 

DNA repair

      Pages: 997-998

The ABC excinuclease is essential in:

 

  1. base-excision repair.
  2. methyl-directed repair.
  3. mismatch repair.
  4. nucleotide-excision repair.
  5. SOS repair.

 

DNA repair

      Page: 999

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:

 

  1. coenzyme A.
  2. coenzyme Q.
  3. FADH.
  4. pyridoxal phosphate (PLP).
  5. thiamine pyrophosphate (TPP).

 

DNA repair

      Page: 994-1000

Which mechanism is used to repair a thymidine dimer in DNA?

 

  1. mismatch repair
  2. base-excision repair
  3. nucleotide-excision repair
  4. direct repair
  5. more than one is used for this type of lesion

 

DNA repair

      Page: 994-1000

Which mechanism is used to repair a chemically-modified base in DNA?

 

  1. mismatch repair
  2. base-excision repair
  3. nucleotide-excision repair
  4. direct repair
  5. more than one is used for this type of lesion

 

DNA repair

Pages: 1001-1002

An alternative repair system by error-prone translesion DNA synthesis can result in a high mutation rate, because:

 

  1. alternative modified nucleotides can be incorporated more readily.
  2. interference from the RecA and SSB proteins hinders the normal replication accuracy.
  3. replication proceeds much faster than normal, resulting in many more mistakes.
  4. the DNA polymerases involved cannot facilitate base-pairing as well as DNA polymerase III.
  5. the DNA polymerases involved lack exonuclease proofreading activities.

 

DNA recombination

      Page: 1007                       

In homologous recombination in E. coli, the protein that moves along a double-stranded DNA, unwinding the strands ahead of it and degrading them, is:

 

  1. DNA ligase.
  2. RecA protein.
  3. RecBCD enzyme.
  4. RuvC protein (resolvase).

 

DNA recombination

      Pages: 1007-1008            

In homologous recombination in E. coli, the protein that assembles into long, helical filaments that coat a region of DNA is:

 

  1. DNA methylase.
  2. DNA polymerase.
  3. RecA protein.
  4. RecBCD enzyme.

 

DNA recombination

      Pages: 1007-1008            

In homologous genetic recombination, RecA protein is involved in:

 

  1. formation of Holliday intermediates and branch migration.
  2. introduction of negative supercoils into the recombination products.
  3. nicking the two duplex DNA molecules to initiate the reaction.
  4. pairing a DNA strand from one duplex DNA molecule with sequences in another duplex, regardless of complementarity.
  5. resolution of the Holliday intermediate.

 

DNA recombination

      Page: 1008                       

Which of the following statements is false?  In vitro, the strand-exchange reaction:

 

  1. can include formation of a Holliday intermediate.
  2. is accompanied by ATP hydrolysis.
  3. may involve transient formation of a three- or four-stranded DNA complex.
  4. needs RecA protein.
  5. requires DNA polymerase.

 

 

DNA recombination

Page: 1012                       

The bacteriophage l can lysogenize after infecting a bacterium, i.e. integrate into the host bacterial chromosome by site-specific recombination, and may reside there for many generations before an excision event regenerates the viral genome in an infective form.  Which one of the following is not a component of these events?

 

  1. Excision requires two host proteins and two virally-encoded proteins.
  2. Integration requires a viral-specific protein, called integrase.
  3. RecA protein is required to catalyze the insertional recombination event.
  4. The excision event relies on different sequences than the integration event.
  5. The virus and the host DNAs share a 15 bp “core” region of perfect homology.

 

 

Short Answer Questions

 

DNA replication

      Pages: 977-978    

Describe briefly how equilibrium density gradient centrifugation was used to demonstrate that DNA replication in E. coli is semiconservative.

 

     

DNA replication

      Page: 979 

The DNA below is replicated from left to right.  Label the templates for leading strand and lagging strand synthesis.

 

(5)ACTTCGGATCGTTAAGGCCGCTTTCTGT(3)

(3)TGAAGCCTAGCAATTCCGGCGAAAGACA(5)

 

     

DNA replication

      Page: 979 

      All known DNA polymerases catalyze synthesis only in the 5 ® 3 direction.  Nevertheless, during semiconservative DNA replication in the cell, they are able to catalyze the synthesis of both daughter chains, which would appear to require synthesis in the 3 ® 5 direction.  Explain the process that occurs in the cell that allows for synthesis of both daughter chains by DNA polymerase.

 

     

DNA replication

      Pages: 979, 987   

What is an Okazaki fragment?  What enzyme(s) is (are) required for its formation in E. coli?

 

     

DNA replication

      Page: 980 

      Diagram the reaction catalyzed by DNA polymerase that occurs between deoxyribose at the end of a DNA chain and the 5 phosphates of a deoxyribonucleoside triphosphate.  Include the chemical structure of the phosphate group, indicate the locations of the sugar and base, and show the rearrangements of electrons that occur.

 

     

DNA replication

      Page: 980 

Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one phosphodiester bond is broken and one is formed).  Nevertheless, the reaction proceeds efficiently both in a test tube and in the cell.  Explain.

 

     

DNA replication

      Pages: 980-981    

A suitable substrate for DNA polymerase is shown below.  Label the primer and template, and indicate which end of each strand must be 3 or 5.

 

To observe DNA synthesis on this substrate in vitro, what additional reaction components must be added?

 

     

 

DNA replication

      Pages: 981, 984   

All known DNA polymerases can only elongate a preexisting DNA chain (i.e., require a primer), but cannot initiate a new DNA chain.  Nevertheless, during semiconservative DNA replication in the cell, entirely new daughter DNA chains are synthesized. Explain the process that occurs in the cell that allows for the synthesis of daughter chains by DNA polymerase.

 

     

DNA replication

      Pages: 985-991    

DNA replication in E. coli begins at a site in the DNA called the (a) ___________.  At the replication fork the (b) ___________ strand is synthesized continuously while the (c) _________ strand is synthesized discontinuously.  On the strand synthesized discontinuously, the short pieces are called (d) ____________ fragments.  An RNA primer for each of the fragments is synthesized by an enzyme called (e) __________, and this RNA primer is removed after the fragment is synthesized by the enzyme (f) ___________, using its (g) _____________ activity.  The nicks left behind in this process are sealed by the enzyme (h) _____________.

 

     

DNA replication

      Pages: 985-991    

Briefly describe the biochemical role of the following enzymes in DNA replication in E. coli:

(a) DNA helicase; (b) primase; (c) the 3 ® 5 exonuclease activity of DNA polymerase; (d) DNA 1igase; (e) topoisomerases; (f) the 5 ® 3 exonuclease activity of DNA polymerase I.

 

     

DNA replication

      Pages: 988-989    

DNA synthesis on the lagging strand in E. coli is a complex process known to involve several proteins.  Initiation of a new chain is catalyzed by the enzyme (a) _____________, and elongation is catalyzed by the enzyme (b)______________.  Synthesis is discontinuous, yielding short segments called (c) _______________, which are eventually joined by the enzyme (d)______________, which requires the cofactor (e)___________.

 

     

DNA replication

      Page: 989 

List two proteins or enzymes, other than DNA polymerase III, that are found at the replication fork in E. coli; describe each of their functions with no more than one sentence.

 

     

DNA replication

Pages: 989-990    

In the bacterial cell, what are catenated chromosomes, when do they arise, and how does the cell resolve the problem posed by their structure?

 

DNA replication

Page: 992 

Why is the drug acyclovir effective against the herpes simplex virus?

 

 

DNA repair

Page: 993-994                  

The high fidelity of DNA replication is due primarily to immediate error correction by the 3′ —> 5′ exonuclease (proofreading) activity of the DNA polymerase.  Some incorrectly paired bases escape this proofreading, and further errors can arise from challenges to the chemical integrity of the DNA.  List the four classes of repair mechanisms that the cell can use to help correct such errors.

 

 

DNA repair

      Page: 993 

List three types of DNA damage that require repair.

 

     

 

DNA repair

      Pages: 993-1000  

Match the damage type or repair step at the left with a related enzyme at right.  Only one answer will be the most direct for each.

 

___ cytosine deamination                                         (a)  hypoxanthine-N-glycosylase

___ base loss                                                            (b)  AP endonuclease

___ adenine deamination                                          (c)  mutH protein

___ binds to GATC sequences                                 (d)  DNA polymerase I

___ binds to mismatch in DNA                                (e)  uracil N-glycosylase

___ DNA synthesis in gaps                                       (f)  mutS-mutL complex

___ seals nicks                                                         (g)  ABC excinuclease

___ O6-methylguanine                                              (h)  DNA photolyase

___ direct chemical reversal                                     (i)  O6-methylguanine

of pyrimidine dimer formation                                 methyltransferase

___ double-strand break                                           (j)  DNA ligase

___ excision of a lesion-                                          (k)  l integrase

containing oligonucleotide                                  (l)  RecA protein

  • restriction endonuclease

 

     

DNA repair

      Pages: 996-997    

Explain the role of DNA glycosylases in DNA repair.

 

     

DNA repair

      Page: 996-998      

Briefly explain the difference between base-excision repair and nucleotide-excision repair.

 

     

DNA repair

      Page: 996-998      

Describe the process of nucleotide-excision repair of lesions like pyrimidine dimers in E. coli.

 

     

 

DNA repair

Page: 1000           

Why does DNA damage that causes alkylation of nucleotides sometimes lead to transition mutations?

 

 

DNA repair

Page: 1000            Difficulty: 1

Explain how inheriting mutations in genes encoding DNA repair enzymes could lead to increased

cancer risk.

 

DNA Recombination

Pages: 1004-1006

 

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

 

 

DNA recombination

      Pages: 1011-1012

Name the three possible outcomes or consequences (at the DNA level) of a site-specific recombination event. For each of these explain concisely (in one sentence) how the relative location and orientation of the recombination sites determines the outcome of the recombination event.  Do not describe specific examples of site-specific recombination systems.

 

     

DNA recombination

Pages: 1013-1014            

What distinguishes the simple from the complex class of bacterial transposon?

 

 

DNA recombination

Pages: 1013-1014            

What distinguishes the two mechanistic pathways for transposition in bacteria, and what is a cointegrate?

 

 

DNA recombination

      Pages: 1014-1016

Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.

 

     

 

Chapter 26   RNA Metabolism

 

 

 

Multiple Choice Questions

 

  1. DNA-dependent synthesis of RNA

Pages: 1022-1023

RNA polymerase:

 

  1. binds tightly to a region of DNA thousands of base pairs away from the DNA to be transcribed.
  2. can synthesize RNA chains de novo (without a primer).
  3. has a subunit called l (lambda), which acts as a proofreading ribonuclease.
  4. separates DNA strands throughout a long region of DNA (up to thousands of base pairs), then copies one of them.
  5. synthesizes RNA chains in the 3 ® 5

 

  1. DNA-dependent synthesis of RNA

Pages: 1022-1024

Which of the following statements about E. coli RNA polymerase is false?

 

  1. Core enzyme selectively binds promoter regions, but cannot initiate synthesis without a sigma factor.
  2. RNA polymerase holoenzyme has several subunits.
  3. RNA produced by this enzyme will be completely complementary to the DNA template.
  4. The enzyme adds nucleotides to the 3 end of the growing RNA chain.
  5. The enzyme cannot synthesize RNA in the absence of DNA.

 

  1. DNA-dependent synthesis of RNA

Pages: 1022-1025

Which of the following statements about E. coli RNA polymerase (core enzyme) is false?

 

  1. In the absence of the s subunit, core polymerase has little specificity for where initiation begins.
  2. The core enzyme contains several different subunits.
  3. The core enzyme has no polymerizing activity until the s subunit is bound.
  4. The RNA chain grows in a 5 ® 3
  5. The RNA product is complementary to the DNA template.

 

  1. DNA-dependent synthesis of RNA

Page: 1024           

RNA polymerase from E. coli (core enzyme alone) has all of the following properties except that it:

 

  1. can extend an RNA chain and initiate a new chain.
  2. is required for the synthesis of mRNA, rRNA, and tRNA in coli.
  3. produces an RNA polymer that begins with a 5-triphosphate.
  4. recognizes specific start signals in DNA.
  5. requires all four ribonucleoside triphosphates and a DNA template.

 

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1024-1025

The sigma factor of E. coli RNA polymerase:

 

  1. associates with the promoter before binding core enzyme.
  2. combines with the core enzyme to confer specific binding to a promoter.
  3. is inseparable from the core enzyme.
  4. is required for termination of an RNA chain.
  5. will catalyze synthesis of RNA from both DNA template strands in the absence of the core enzyme.

 

  1. DNA-dependent synthesis of RNA

Pages: 1025-1029

After binding by E. coli RNA polymerase, the correct order of events for transcription initiation is:

 

  1. closed complex formation, open complex formation, promoter clearance, start of RNA synthesis.
  2. closed complex formation, open complex formation, start of RNA synthesis, promoter clearance.
  3. open complex formation, closed complex formation, start of RNA synthesis, promoter clearance.
  4. start of RNA synthesis, closed complex formation, open complex formation, promoter clearance.
  5. start of RNA synthesis, open complex formation, closed complex formation, promoter clearance.

 

  1. DNA-dependent synthesis of RNA

Pages: 1027-1029

Which one of the following statements about E. coli RNA polymerase (core enzyme) is false?

 

  1. It can start new chains de novo or elongate old ones.
  2. It has no catalytic activity unless the sigma factor is bound.
  3. It uses nucleoside 5-triphosphates as substrates.
  4. Its activity is blocked by rifampicin.
  5. Its RNA product will hybridize with the DNA template.

 

  1. DNA-dependent synthesis of RNA

Page: 1026                       

“Footprinting” or DNase protection is a technique used to identify:

 

  1. a region of DNA that has been damaged by mutation.
  2. coli cells that contain a desired, cloned piece of DNA.
  3. the position of a particular gene of a chromosome.
  4. the position of internally double-stranded regions in a single-stranded DNA molecule.
  5. the specific binding site of a repressor, polymerase, or other protein on the DNA.

 

  1. DNA-dependent synthesis of RNA

Page: 1030

Which one of the following statements about eukaryotic RNA polymerases is correct?

 

  1. All three eukaryotic RNA polymerases recognize the same promoters as prokaryotic polymerases.
  2. None of the eukaryotic RNA polymerases recognizes prokaryotic promoters.
  3. Only eukaryotic RNA polymerase I recognizes prokaryotic promoters.
  4. Only eukaryotic RNA polymerase II recognizes prokaryotic promoters.
  5. Only eukaryotic RNA polymerase III recognizes prokaryotic promoters.
  6. DNA-dependent synthesis of RNA

Pages: 1030-1032

Which of the following is not known to be involved in initiation by eukaryotic RNA polymerase II?

 

  1. DNA helicase activity
  2. DNA polymerase activity
  3. Formation of an open complex
  4. Protein binding to specific DNA sequences
  5. Protein phosphorylation

 

  1. RNA processing

Pages: 1033-1034            

Processing of a primary mRNA transcript in a eukaryotic cell does not normally involve:

 

  1. attachment of a long poly(A) sequence at the 3
  2. conversion of normal bases to modified bases, such as inosine and pseudouridine.
  3. excision of intervening sequences (introns).
  4. joining of exons.
  5. methylation of one or more guanine nucleotides at the 5

 

  1. RNA processing

Page: 1035                       

The 5-terminal cap structure of eukaryotic mRNAs is a(n):

 

  1. 7-methylcytosine joined to the mRNA via a 2,3-cyclic linkage.
  2. 7-methylguanosine joined to the mRNA via a 5 ® 3 diphosphate linkage.
  3. 7-methylguanosine joined to the mRNA via a 5 ® 5 triphosphate linkage.
  4. N6-methyladenosine joined to the mRNA via a 5 ® 5 phosphodiester bond.
  5. O6-methylguanosine joined to the mRNA via a 5 ® 5 triphosphate linkage.

 

  1. RNA processing

Page: 1036

The excision (splicing) of many group I introns requires, in addition to the primary transcript RNA:

 

  1. a cytosine nucleoside or nucleotide and a protein enzyme.
  2. a guanine nucleoside or nucleotide (only).
  3. a protein enzyme only.
  4. a small nuclear RNA and a protein enzyme.
  5. ATP, NAD, and a protein enzyme.

 

  1. RNA processing

Page: 1036                                   

A branched (“lariat”) structure is formed during:

 

  1. attachment of a 5 cap to mRNA.
  2. attachment of poly(A) tails to mRNA.
  3. processing of preribosomal RNA.
  4. splicing of all classes of introns.
  5. splicing of group II introns.

 

  1. RNA processing

Page: 1036                       

Splicing of introns in nuclear mRNA primary transcripts requires:

 

  1. a guanine nucleoside or nucleotide.
  2. polynucleotide phosphorylase.
  3. RNA polymerase II.
  4. small nuclear ribonucleoproteins (snurps).

 

  1. RNA processing

Page: 1040                       

Which one of the following is not true of the mRNA for ovalbumin?

 

  1. Exons are used for polypeptide synthesis.
  2. Introns are complementary to their adjacent exons and will form hybrids with them.
  3. The mature mRNA is substantially shorter than the corresponding region on the DNA.
  4. The mRNA is originally synthesized in the nucleus, but ends up in the cytoplasm.
  5. The splicing that yields a mature mRNA occurs at very specific sites in the RNA primary transcript.

 

  1. RNA processing

Page: 1040                                   

Differential RNA processing may result in:

 

  1. a shift in the ratio of mRNA produced from two adjacent genes.
  2. attachment of the poly(A) tail to the 5 end of an mRNA.
  3. inversion of certain exons in the final mRNA.
  4. the production of the same protein from two different genes.
  5. the production of two distinct proteins from a single gene.

 

  1. RNA processing

Pages: 1042-1045            

Which of the following statements about the synthesis of rRNA and tRNA in E. coli is true?

 

  1. Both rRNA and some tRNAs are part of the same primary transcript.
  2. Each rRNA sequence (16S, 23S, 5S) is transcribed into a separate primary transcript.
  3. Primary tRNA transcripts undergo methylation, but rRNA sequences are not methylated.
  4. The tRNA sequences all lie at the 3’end of the rRNA transcripts
  5. There is a single copy of the rRNA genes.

 

  1. RNA processing

Pages: 1046-1047

Which of the following is not usually essential for the catalytic activity of ribozymes?

 

  1. Correct base pairing
  2. Correct base sequence
  3. Correct interaction with protein
  4. Correct secondary structure
  5. Correct three-dimensional structure

 

  1. RNA processing

Page: 1048                       

Which one of the following properties of the L-19 IVS ribozyme is not shared with enzymes that are purely protein?

 

  1. It acts as a true catalyst.
  2. It can be competitively inhibited.
  3. It displays Michaelis-Menten kinetics.
  4. It exploits base-pairing with internal guide sequences.
  5. It makes use of covalent and metal ion catalysis.

 

  1. RNA processing

Pages: 1048-1049                        

Which one of the following statements about mRNA stability is true?

 

  1. Degradation always proceeds in the 5 to 3
  2. Degradation of mRNA by polynucleotide phosphorylase yields 5-nucleoside monophosphates.
  3. In general, bacterial mRNAs have longer half-lives than do eukaryotic mRNAs.
  4. Rates of mRNA degradation ared always at least 10-fold slower than rates of mRNA synthesis.
  5. Secondary structure in mRNA (hairpins, for example) slows the rate of degradation.

 

  1. RNA-dependent synthesis of RNA and DNA

Page: 1050                       

The reverse transcriptase of an animal RNA virus catalyzes:

 

  1. degradation of the RNA strand in a DNA-RNA hybrid.
  2. insertion of the viral genome into a chromosome of the host (animal) cell.
  3. RNA formation in the 3 ® 5
  4. RNA synthesis, but not DNA synthesis.
  5. synthesis of an antisense RNA transcript.

 

  1. RNA-dependent synthesis of RNA and DNA

Page: 1051                       

Reverse transcriptase:

 

  1. can utilize only RNA templates.
  2. has a 3 ® 5 proofreading exonuclease but not a 5 ® 3
  3. is activated by AZT.
  4. is encoded by retroviruses.
  5. synthesizes DNA with the same fidelity as a typical DNA polymerase.

 

  1. RNA-dependent synthesis of RNA and DNA

Page: 1051                       

Compared with DNA polymerase, reverse transcriptase:

 

  1. does not require a primer to initiate synthesis.
  2. introduces no errors into genetic material because it synthesizes RNA, not DNA.
  3. makes fewer errors in synthesizing a complementary polynucleotide.
  4. makes more errors because it lacks the 3 ® 5 proofreading exonuclease activity.
  5. synthesizes complementary strands in the opposite direction¾from 3 ® 5.
  6. RNA-dependent synthesis of RNA and DNA

Page: 1053                       

AZT (3-azido-2,3-dideoxythymidine), used to treat HIV infection, acts in HIV-infected cells by:

 

  1. blocking ATP production.
  2. blocking deoxynucleotide synthesis.
  3. inhibiting reverse transcriptase.
  4. inhibiting RNA polymerase II.
  5. inhibiting RNA processing.

 

  1. RNA-dependent synthesis of RNA and DNA

Page: 1056                                   

 

Which one of the following statements about the reverse transcriptases of retroviruses and the RNA replicases of other single-stranded RNA viruses, such as R17 and influenza virus, is correct?

 

  1. A) Both enzymes can synthesize either RNA or DNA from an RNA template strand.
  2. B) Both enzymes can utilize DNA in addition to RNA as a template strand.
  3. C) Both enzymes carry the specificity for the RNA of their own virus.
  4. D) Both enzymes have error rates similar to those of cellular RNA polymerases.
  5. E) Both enzymes require host-encoded subunits for their replication function.

 

  1. RNA-dependent synthesis of RNA and DNA

Pages: 1058-1059

 

Aptamers are:

 

  1. A) double-stranded RNA products of nuclease action on hairpin RNAs.
  2. B) repeat sequence elements at the ends of transposons.
  3. C) small RNA molecules selected for tight binding to specific molecular targets.
  4. D) the RNA primers required for retroviral replication.
  5. E) the short tandem repeat units found in telomeres.

 

  1. RNA Metabolism

Pages: 1021-1059

 

Which of these polymerases does not require a template?

 

  1. A) RNA pol I
  2. B) RNA pol II
  3. C) Reverse Transcriptase
  4. D) Polyadenylate polymerase
  5. E) RNA replicase

 

Short Answer Questions

 

  1. DNA-dependent synthesis of RNA

Pages: 1022-1023

Consider the following small hypothetical gene.  The DNA bases corresponding to the first and last mRNA nucleotides are indicated by a “+” and a “*” respectively. Give the sequence(s) of the mRNA strand(s) produced by this gene.

 

+                 *

5’-GGCTATGTACGTAGCTACGTA-3’

|||||||||||||||||||||

3’-CCGATACATGCATCGATGCAT-5’

 

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1022-1023

Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence:

(5)ATCGTACCGTTA(3)

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1021-1024

List one basic property that distinguishes RNA polymerases from DNA polymerases, and list one basic property they share.

 

  1. DNA-dependent synthesis of RNA

Pages: 1022-1023

Below, an RNA molecule is being transcribed from a strand of DNA.  Indicate the 5 and 3 ends of the RNA molecule and of the strand of DNA that is complementary to the RNA molecule.  In which direction is synthesis occurring?

 

 

 

 

 

 

 

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1025-1033

For each of the following statements, indicate with a P if the statement applies only to prokaryotes, an E if the statement applies only to eukaryotes, and an E & P if the statement applies to both eukaryotes and prokaryotes.

 

___ RNA synthesis is blocked by actinomycin D.

___ A single RNA polymerase transcribes genes that encode mRNAs, tRNAs, and rRNA.

___ Transcription of mRNA is blocked by a-amanitin.

___ Sigma (s) subunit detaches from RNA polymerase shortly after transcription has initiated.

___ The 5 end of the mature mRNA begins with a triphosphate.

___ The primary mRNA transcript is inacitve.

___ Termination of transcription requires the protein r factor.

 

  1. DNA-dependent synthesis of RNA

Page: 1025           

The specific sequences that E. coli RNA polymerase usually binds to in E. coli DNA before initiating transcription generally contain more A=T base pairs than GºC base pairs.  In no more than a few sentences, speculate on why this might be the case.

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1025-1029

Describe the sequence of events in the initiation of transcription by E. coli RNA polymerase.

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1029-1030

In a r-independent terminator, there is a palindrome rich in GºC base pairs, followed by 8–10 uridine residues.  Explain how each of the following changes might affect terminator function:  (a) Substitution of cytidines for the 8–10 uridines.  (b) Mutations in the palindrome that decrease its GºC content.  (c) Elimination of half of the palindromic sequence.

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1029-1030

Compare and contrast r-dependent and r-independent termination of transcription in prokaryotes.

 

  1. DNA-dependent synthesis of RNA

Page: 1026                       

The DNA molecule below is believed to contain a binding site for protein X.  It is labeled at the 5 end of the top strand (*), then subjected to a footprinting experiment.  In the idealized gel below, there is a band for every base of the labeled strand.  On the DNA sequence, point out the binding site for protein X.

 

*(5)GGATTCTAATAAAGTAACGCGTTACGACTTGG

CCTAAGATTATTTCATTGCGCAATGCTGAACC

 

[

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1030-1032 Difficulty:3

Describe briefly the process of initiation by eukaryotic RNA polymerase.

 

  1. DNA-dependent synthesis of RNA

Pages: 1030-1033

Indicate whether each of the following statements about eukaryotic cells is true (T) or false (F).

 

___ They have three distinct RNA polymerases.

___ Their mRNAs are generally synthesized by RNA polymerase I.

___ RNA polymerase III synthesizes only rRNAs.

___ The 5S rRNA is synthesized by RNA polymerase I

___ Their RNA polymerases initiate transcription at specific promoter sites on the DNA

 

 

  1. DNA-dependent synthesis of RNA

Pages: 1033         

Rifampicin blocks RNA polymerase; why would this be lethal to a cell that was sensitive to this drug?

 

 

  1. RNA processing

Pages: 1033-1044

Name four general types of postsynthetic processing reactions that are observed in RNA.  Briefly (one sentence or less) point out an example of each type.  In your example, identify the type of RNA molecule involved (tRNA, mRNA, rRNA, etc.), the type of “processing” involved, and whether the example is characteristic of eukaryotes or prokaryotes, or both.  Do not describe specific genes, sequences, complicated structures, or enzymes.

 

 

  1. RNA processing

Pages: 1035, 1039-1040  

Describe in words (not using structures) the important features of the structures present on the 5 and 3 ends of mature (processed) eukaryotic mRNAs.

 

t

  1. RNA processing

Pages: 1036-1038

Describe the mechanistic difference that distinguishes the splicing of group I introns from that of group II introns.

 

 

  1. RNA processing

Page: 1039                       

Describe the function of polyadenylate polymerase and name two properties that distinguish it from normal cellular RNA polymerases.

 

 

  1. RNA processing

Page: 1045                       

Beginning with the primary transcript containing a tRNA sequence, describe the steps in the formation of a mature tRNA molecule in E. coli.

 

 

 

  1. RNA processing

Pages: 1045, 1048           

In 1989, Sidney Altman won a Nobel Prize for his work on RNase P.  In no more than three sentences, describe the function of RNase P, as well as the unusual characteristic of this enzyme that made Altman’s work so important.

 

 

  1. RNA processing

Page: 1042                       

Transfer RNAs have several bases in addition to the normal four found in RNA.  How are these rare bases incorporated into the tRNA molecule?

 

  1. RNA processing

Pages: 1045-1048

Define ribozymes and briefly describe the structure and function of two ribozymes.

 

 

  1. RNA-dependent synthesis of RNA and DNA

Pages: 1022, 1050-1051  

Compare transcription and reverse transcription in terms of the following characteristics:

 

(a) direction of polynucleotide synthesis

(b) nature of template

(c) nature of primer

(d) incorporated nucleotides

 

 

  1. RNA-dependent synthesis of RNA and DNA

Page: 1051                       

Describe all of the known catalytic activities of reverse transcriptase.

 

 

  1. RNA-dependent synthesis of RNA and DNA

Pages: 1053-1056

What is a telomere?  Describe the key features of its structure.  What is unusual about the structure and/or mechanism of action of telomerase?

 

 

  1. RNA processing

Pages: 1056-1057            

Why did the “RNA World” hypothesis have to await the discovery of ribozymes in order to become a widely attractive scenario?

 

 

  1. RNA-dependent synthesis of RNA and DNA

Pages: 1058-1059            

What is the utility of the SELEX protocol and how does it work?

 

Chapter 27   Protein Metabolism

 

 

 

Multiple Choice Questions

 

  1. The genetic code

Page: 1069                                   

A certain bacterial mRNA is known to represent only one gene and to contain about 800 nucleotides.  If you assume that the average amino acid residue contributes 110 to the peptide molecular weight, the largest polypeptide that this mRNA could code for would have a molecular weight of about:

 

  1. 5,000.
  2. 30,000.
  3. 80,000.
  4. An upper limit cannot be determined from the data given.

 

  1. The genetic code

Page: 1038                                   

Assuming that the average amino acid residue contributes 110 to the peptide molecular weight, what will be the minimum length of the mRNA encoding a protein of molecular weight 50,000?

 

  1. 133 nucleotides
  2. 460 nucleotides
  3. 1,400 nucleotides
  4. 5,000 nucleotides
  5. A minimum length cannot be determined from the data given.

 

  1. The genetic code

Pages: 1070-1074

Which of the following are features of the wobble hypothesis?

 

  1. A naturally occurring tRNA exists in yeast that can read both arginine and lysine codons.
  2. A tRNA can recognize only one codon.
  3. Some tRNAs can recognize codons that specify two different amino acids, if both are nonpolar.
  4. The “wobble” occurs only in the first base of the anticodon.
  5. The third base in a codon always forms a normal Watson-Crick base pair.

 

  1. The genetic code

Page: 1069                                   

Which one of the following is true about the genetic code?

 

  1. All codons recognized by a given tRNA encode different amino acids.
  2. It is absolutely identical in all living things.
  3. Several different codons may encode the same amino acid.
  4. The base in the middle position of the tRNA anticodon sometimes permits “wobble” base pairing with 2 or 3 different codons.
  5. The first position of the tRNA anticodon is always adenosine.

 

  1. Protein synthesis

Pages: 1076-1077

Which one of the following statements about ribosomes is true?

 

  1. The large subunit contains rRNA molecules, the small subunit does not.
  2. The RNA in ribosomes plays a structural, not catalytic, role.
  3. There are about 25 of them in an coli cell.
  4. There are two major subunits, each with multiple proteins.
  5. They are relatively small, with molecular weights less than 10,000.

 

  1. Protein synthesis

Pages: 1079-1080

Which of the following statements about tRNA molecules is false?

 

  1. A, C, G, and U are the only bases present in the molecule.
  2. Although composed of a single strand of RNA, each molecule contains several short, double-helical regions.
  3. Any given tRNA will accept only one specific amino acid.
  4. The amino acid attachment is always to an A nucleotide at the 3 end of the molecule.
  5. There is at least one tRNA for each of the 20 amino acids.

 

  1. Protein synthesis

Page: 1080

Which of the following statements about the tRNA that normally accepts phenylalanine is false?  (mRNA codons for phenylalanine are UUU and UUC.)

 

  1. It interacts specificially with the Phe synthetase.
  2. It will accept only the amino acid phenylalanine.
  3. Its molecular weight is about 25,000.
  4. Phenylalanine can be specifically attached to an —OH group at the 3
  5. The tRNA must contain the sequence UUU.

 

  1. Protein synthesis

Page: 1081

Which of the following is not true of tRNA molecules?

 

  1. The 3-terminal sequence is —CCA.
  2. Their anticodons are complementary to the triplet codon in the mRNA.
  3. They contain more than four different bases.
  4. They contain several short regions of double helix.
  5. With the right enzyme, any given tRNA molecule will accept any of the 20 amino acids.

 

  1. Protein synthesis

Page: 1081

Aminoacyl-tRNA synthetases (amino acid activating enzymes):

 

  1. “recognize” specific tRNA molecules and specific amino acids.
  2. in conjunction with another enzyme attach the amino acid to the tRNA.
  3. interact directly with free ribosomes.
  4. occur in multiple forms for each amino acid.
  5. require GTP to activate the amino acid.
  6. Protein synthesis

Page: 1081-1083

In E. coli, aminoacyl-tRNA synthetases:

 

  1. activate amino acids in 12 steps.
  2. are amino acid–specific; there is at least one enzyme specific for each amino acid.
  3. fall into two classes, each of which attaches amino acids to different ends of the tRNA.
  4. have no proofreading activities.
  5. require a tRNA, an amino acid, and GTP as substrates.

 

  1. Protein synthesis

Pages: 1081-1084

Which of the following statements about aminoacyl-tRNA synthetases is false?

 

  1. Some of the enzymes have an editing/proofreading capability.
  2. The enzyme attaches an amino acid to the 3 end of a tRNA.
  3. The enzyme splits ATP to AMP + PPi.
  4. The enzyme will use any tRNA species, but is highly specific for a given amino acid.
  5. There is a different synthetase for every amino acid.

 

  1. Protein synthesis

Pages: 1081-1082

The enzyme that attaches an amino acid to a tRNA (aminoacyl-tRNA synthetase):

 

  1. always recognizes only one specific tRNA.
  2. attaches a specific amino acid to any available tRNA species.
  3. attaches the amino acid at the 5 end of the tRNA.
  4. catalyzes formation of an ester bond.
  5. splits ATP to ADP + Pi.

 

  1. Protein synthesis

Pages: 1081-1082

In the “activation” of an amino acid for protein synthesis:

 

  1. leucine can be attached to tRNAPhe, by the aminoacyl-tRNA synthetase specific for leucine.
  2. methionine is first formylated, then attached to a specific tRNA.
  3. the amino acid is attached to the 5 end of the tRNA through a phosphodiester bond.
  4. there is at least one specific activating enzyme and one specific tRNA for each amino acid.
  5. two separate enzymes are required, one to form the aminoacyl adenylate, the other to attach the amino acid to the tRNA.

 

  1. Protein synthesis

Page: 1088

Which of the following is(are) true for protein synthesis in eukaryotes?

 

  1. All proteins are initially synthesized with methionine at their C-terminus.
  2. All proteins are initially synthesized with methionine at their N-terminus.
  3. All proteins are initially synthesized with tryptophan at their C-terminus.
  4. All proteins are initially synthesized with a multiple of 3 amino acids in their sequence.
  5. None of the above.

 

  1. Protein synthesis

Pages: 1088-1089

Formation of the ribosomal initiation complex for bacterial protein synthesis does not require:

 

  1. EF-Tu.
  2. formylmethionyl tRNAfMet.
  3. initiation factor 2 (IF-2).

 

  1. Protein synthesis

Page: 1091

In bacteria the elongation stage of protein synthesis does not involve:

 

  1. aminoacyl-tRNAs.
  2. EF-Tu.
  3. IF-2.
  4. peptidyl transferase.

 

  1. Protein synthesis

Page: 1091

Which one of the following statements about the elongation phase of protein synthesis is true?

 

  1. At least five high-energy phosphoryl groups are expended for each peptide bond formed.
  2. During elongation, incoming aminoacylated tRNAs are first bound in the P site.
  3. Elongation factor EF-Tu facilitates translocation.
  4. Peptidyl transferase catalyzes the attack of the carboxyl group of the incoming amino acid on an ester linkage in the nascent polypeptide.
  5. Peptidyl transferase is a ribozyme.

 

  1. Protein synthesis

Pages: 1092-1093

Which of the following statements about bacterial mRNA is true?

 

  1. A ribosome usually initiates translation near the end of the mRNA that is synthesized last.
  2. An mRNA is never degraded but is passed on to the daughter cells at cell division.
  3. During polypeptide synthesis, ribosomes move along the mRNA in the direction 5 ® 3.
  4. Ribosomes cannot initiate internally in a polycistronic transcript.
  5. The codon signaling peptide termination is located in the mRNA near its 5

 

  1. Protein synthesis

Pages: 1092-1093

Bacterial ribosomes:

 

  1. bind tightly to specific regions of DNA, forming polysomes.
  2. contain at least one catalytic RNA molecule (ribozyme).
  3. contain three species of RNA and five different proteins.
  4. have specific, different binding sites for each of the 20 tRNAs.
  5. require puromycin for normal function.

 

  1. Protein synthesis
Page: 1096

The large structure consisting of a mRNA molecule being translated by multiple copies of the macromolecular complexes that carry out protein synthesis is called a:

 

 

  1. Protein synthesis

Page: 1093

It is possible to convert the Cys that is a part of Cys-tRNACys to Ala by a catalytic reduction.  If the resulting Ala-tRNACys were added to a mixture of (1) ribosomes, (2) all the other tRNAs and amino acids, (3) all of the cofactors and enzymes needed to make protein in vitro, and (4) mRNA for hemoglobin, where in the newly synthesized hemoglobin would the Ala from Ala-tRNACys be incorporated?

 

  1. Nowhere; this is the equivalent of a nonsense mutation
  2. Wherever Ala normally occurs
  3. Wherever Cys normally occurs
  4. Wherever either Ala or Cys normally occurs
  5. Wherever the dipeptide Ala-Cys normally occurs

 

  1. Protein synthesis

Page: 1095

Approximately how many NTPs must be converted to NDPs to incorporate one amino acid into a protein?

 

  1. 0
  2. 1
  3. 2
  4. 4
  5. 8

 

  1. Protein synthesis

Pages: 1088-1089

Which one of the following antibiotics does not function by interfering with the translational process?

 

  1. Chloramphenicol
  2. Cycloheximide
  3. Penicillin
  4. Puromycin
  5. Streptomycin

 

  1. Protein targeting and degradation

Page: 1101

Which of the following is true about the sorting pathway for proteins destined for incorporation into lysosomes or the plasma membrane of eukaryotic cells?

 

  1. Binding of SRP to the signal peptide and the ribosome temporarily accelerates protein synthesis.
  2. The newly synthesized polypeptides include a signal peptide at their carboxyl termini.
  3. The signal peptide is cleaved off inside the mitochondria by signal peptidase.
  4. The signal recognition particle (SRP) binds to the signal peptide soon after it appears outside the ribosome.
  5. The signal sequence is added to the polypeptide in a posttranslational modification reaction.

 

  1. Protein targeting and degradation

Pages: 1101-1102

Glycosylation of proteins inside the endoplasmic reticulum does not involve:

 

  1. a His residue on the protein.
  2. an Asn residue on the protein.
  3. dolichol phosphate.
  4. N-acetylglucosamine.

 

  1. Protein targeting and degradation

Page: 1102

Posttranslational glycosylation of proteins is inhibited specifically by:

 

 

  1. Protein targeting and degradation

Page: 1104

The signal sequences that direct proteins to the nucleus are:

 

  1. always at the amino terminus of the targeted protein.
  2. cleaved after the protein arrives in the nucleus.
  3. glycosyl moieties containing mannose 6-phosphate residues.
  4. not located at the ends of the peptide, but in its interior.
  5. the same as those that direct certain proteins to lysosomes.

 

  1. Protein targeting and degradation

Pages: 1104-1106            

The pathway for polypeptides exported from E. coli includes the following steps, which occur in what order for correct export?

 

  1. A chaperone, SecA, binds to the polypeptide.
  2. A chaperone, SecB, binds to the polypeptide.
  3. ATP is hydrolyzed by Sec A.
  4. SecA pushes 20 amino acids of the polypeptide into the translocation complex.

 

  1. 1, 2, 3, 4
  2. 1, 2, 4, 3
  3. 2, 1, 4, 3
  4. 2, 3, 1, 4
  5. 3, 1, 4, 2

 

  1. Protein targeting and degradation

Page: 1108-1109                          

Ubiquitin-mediated protein degradation is a complex process, and many of the signals remain unknown.  One known signal involves recognition of amino acids in a processed protein that are either stabilizing (Ala, Gly, Met, Ser, etc.) or destabilizing (Arg, Asp, Leu, Lys, Phe, etc.), and are located at:

 

  1. a helix-turn-helix motif in the protein.
  2. a lysine-containing target sequence in the protein.
  3. a zinc finger structure in the protein.
  4. the amino-terminus of the protein.
  5. the carboxy-terminus of the protein.

 

 

 

 

Short Answer Questions

 

  1. The genetic code

Pages: 1066-1067

Outline one of the experimental methods providing evidence that the genetic code was a triplet code.

 

 

  1. The genetic code

Pages: 1066-1068            

Describe, succinctly, two ways in which synthetic polynucleotides were used in solving the genetic code (you need not describe how the synthetic polynucleotides were made).

 

 

  1. The genetic code

Page: 1069                       

You have isolated a fragment of viral DNA that totally encodes at least two proteins, 120 and 80 amino acids long.  The DNA fragment is 400 base pairs long.  (a) Why might you consider this unusual?  (b) You sequence the two proteins and find no sequence homology.  Propose a model to account for these findings.

 

 

  1. The genetic code

Page: 1069                       

Consider the following hypothetical short mRNA; what would be the sequence of the protein produced if this were translated in an E. coli cell?

 

5’-AUAGGAGGUUUGACCUAUGCCUCGUUUAUAGCC-3’

 

  1. The genetic code

Page: 1069                       

The template strand of a segment of double-stranded DNA contains the sequence:

(5)CTT TGA TAA GGA TAG CCC TTC

(a) What is the base sequence of the mRNA that can be transcribed from this strand?  (b) What amino acid sequence could be coded by the mRNA base sequence in (a), using only the first reading frame starting at the 5 end?  (Refer to Fig. 27-7, p. 1069.)  (c) Suppose the other (complementary) strand is used as a template for transcription.  What is the amino acid sequence of the resulting peptide, again starting from the 5 end and using only the first reading frame?

 

 

  1. The genetic code

Page: 1069                       

 

Describe the possible outcomes that could occur because of a single base change in an mRNA

 

 

  1. The genetic code

Page: 1069                       

The following sequence of four amino acids occurred in the structure of a polypeptide found in a wild-type organism:  Leu-Ser-Ile-Arg.  Several mutants were isolated, each of which carried a single base pair change in the region of DNA that coded for this amino acid sequence.  Their corresponding amino acid sequences are:

 

Mutant

1          MET-Ser-Ile-Arg

2          Leu-TRP-Ile-Arg

3          Leu-Ser-ARG-Arg

4          Leu-Ser-Ile-PRO

5          Leu-Ser-Ile-TRP

 

What was the nucleotide sequence of the region of mRNA that coded for the amino acid sequence in the wild-type organism?  (Refer to Fig. 27-6, p. 1069.)

 

  1. The genetic code

Pages: 1070-1074

In protein synthesis, 61 codons specify the 20 amino acids.  Base pairing between the codon and the tRNA anticodon assures that the correct amino acid will be inserted into the nascent polypeptide chain.  Why then does the cell require only 32 different tRNAs to recognize 61 different codons?

 

 

  1. Protein synthesis

Pages: 1076-1079

Indicate whether the following statements are true (T) or false (F).

 

___A ribosome is the complex within which protein synthesis occurs.

___Ribosomes contain many separate proteins.

___The three ribosomal RNAs in a bacterial ribosome are distributed in three separate, large  ribosomal subunits.

___There are four binding sites for aminoacyl-tRNAs on a ribosome.

 

 

  1. Protein synthesis

Pages: 1081-1083

The process of charging tRNAs with their cognate amino acids involves multiple proofreading steps to increase the overall fidelity.  Briefly describe these steps.

 

 

  1. Protein synthesis

Pages: 1083-1084

The recognition of an amino acid by its cognate aminoacyl-tRNA synthetase is said to involve a “second genetic code”.  What is meant by this?

 

  1. Protein synthesis

Page: 1088                       

In 1961, Howard Dintzis carried out an experiment that defined the direction of polypeptide chain growth during protein synthesis in cells.  The experiment involved the analysis of hemoglobin molecules that were being synthesized in reticulocytes in the presence of radioactive amino acids.  Describe the analysis and how it demonstrated the direction of chain growth.

 

 

  1. Protein synthesis

Page: 1088-1090  

A given mRNA sequence might be translated in any of three reading frames.  Describe how prokaryotes and eukaryotes determine the correct reading frame.

 

 

  1. Protein synthesis

Pages: 1088-1095

Match the factor or enzyme at the right with the stage(s) of protein synthesis at which it acts.  If a factor or enzyme participates in two stages of protein synthesis, indicate both of them.

 

___  Amino acid activation               (a) RF1

___  Initiation                                   (b) EF-Tu

___  Elongation                                (c) aminoacyl-tRNA

___  Termination                              (d) Shine-Dalgarno sequence

 

 

  1. Protein synthesis

Pages: 1088-1095

Indicate whether each of the following statements is true (T) or false (F).

 

___Assembly of a complete ribosome onto an mRNA requires ATP hydrolysis.

___Aminoacylation or “charging” of tRNA requires the formation of an aminoacyl-AMP    intermediate.

___Aminoacyl-tRNA binding to the A site of the ribosome requires the accessory factor EF-G and GTP hydrolysis.

___Translocation of a growing polypeptide from the A to the P site on the ribosome requires EF-G and GTP hydrolysis.

___Termination of translation requires release factors, but no NTP hydrolysis.

 

 

  1. Protein synthesis

Pages: 1088-1095

Briefly describe the role of the following components in bacterial protein synthesis.

 

(a) Initiation factor 2 (IF-2)

(b) 16S RNA

(c) Peptidyl transferase

(d) Release factors

(e) Elongation factor G (EF-G)

(f) N10-formyltetrahydrofolate

(g) ATP

(h) tRNAfMet

 

 

  1. Protein synthesis

Pages: 1088-1095

Number the following steps in the proper order with regard to protein synthesis.

 

___ Aminoacyl-tRNA binds to the A site.

___ Deacylated tRNA is released from ribosome.

___ Peptide bond formation shifts the growing peptide from the P to the A site.

___ The 50S subunit binds to the initiation complex of the 30S subunit and mRNA.

 

 

  1. Protein synthesis

Pages: 1088-1096

Indicate whether each of the following statements is true (T) or false (F).

 

___ Bacterial mRNA is broken down within a few minutes of its formation in E. coli.

___ Bacterial mRNA consists only of the bases that code for amino acids.

___ Polysomes do not necessarily contain mRNA.

___ Bacterial mRNA normally occurs as a double-stranded structure, with one strand containing codons, the other containing anticodons.

___ Bacterial mRNA can be translated while it is still being synthesized.

 

 

  1. Protein synthesis

Pages: 1088-1096

Regarding translation in eukaryotes versus that in prokaryotes (bacteria), indicate whether each of the following statements is true (T) or false (F).

 

___ In eukaryotes the 3 end of the mRNA is associated with the 5 end during initiation whereas in prokaryotes it is not.

___ In prokaryotes it is initiated at an AUG near a Shine-Dalgarno sequence in the mRNA whereas in eukaryotes it is initiated at an AUG near the 3 end of the mRNA.

___ In prokaryotes it is initiated with Met whereas in eukaryotes it is initiated with fMet.

___ In prokaryotes translation and transcription are coupled whereas in eukaryotes they are not.

 

 

  1. Protein synthesis

Pages: 1091-1094

Polypeptide chain elongation in E. coli occurs by the cyclical repetition of three steps.  What are these steps and what cellular components are necessary for each of them to occur?

 

 

  1. Protein synthesis

Pages: 1091-1092            

A new antibiotic was recently discovered that inhibits prokaryotic protein synthesis.  In the presence of the antibiotic, protein synthesis can be initiated, but only dipeptides that remain bound to the ribosome are formed.  What specific step of protein synthesis is likely to be blocked by this antibiotic?

 

 

  1. Protein synthesis

Pages: 1096-1098

Following the synthesis of their polypeptide chain, many proteins require further posttranslational modifications before they attain their full biological activity or function.  List and describe briefly at least four possible types of modification that can occur.

 

 

 

  1. Protein synthesis

Page: 1094                       

In no more than three sentences, describe a nonsense suppressor tRNA and how it differs from a normal tRNA.

 

 

 

  1. Protein targeting and degradation

Page: 1100-1101  

When first synthesized, proinsulin has an additional leader or signal peptide at its amino terminus.  This complete molecule is called preproinsulin and the signal peptide is cleaved off to give proinsulin.  Briefly, what is the likely function of the signal peptide?

 

 

  1. Protein targeting and degradation

Page: 1101                       

Describe the sequence of events between the transcription of an mRNA for a secreted protein and the arrival of that protein in the lumen of the endoplasmic reticulum.

 

 

  1. Protein targeting and degradation

Pages: 1104-1106

What are the stages in targeting of nuclear proteins, and why are the targeting sequences not removed upon arrival of the protein in the nucleus?

 

  1. Protein targeting and degradation

Pages: 1107-1108            

Describe the role of ubiquitin in mediating intracellular protein breakdown.

 

 

 

 

Chapter 28   Regulation of Gene Expression

 

 

 

Multiple Choice Questions

 

  1. Principles of gene regulation

Page: 1116                                   

“Housekeeping genes” in bacteria are commonly expressed constitutively, but not all of these genes are expressed at the same level (the same number of molecules per cell).  The primary mechanism responsible for variations in the level of constitutive enzymes from different genes is that:

 

  1. all constitutive enzymes are synthesized at the same rate, but are not degraded equally.
  2. their promoters have different affinities for RNA polymerase holoenzyme.
  3. some constitutively expressed genes are more inducible than others.
  4. some constitutively expressed genes are more repressible than others.
  5. the same number of mRNA copies are made from each gene, but are translated at different rates.

 

  1. Principles of gene regulation

Pages: 1116-1117

Which of the following statements correctly describes promoters in E. coli?

 

  1. A promoter may be present on either side of a gene or in the middle of it.
  2. All promoters have the same sequence that is recognized by RNA polymerase holoenzyme.
  3. Every promoter has a different sequence, with little or no resemblance to other promoters.
  4. Many promoters are similar and resemble a consensus sequence, which has the highest affinity for RNA polymerase holoenzyme.
  5. Promoters are not essential for gene transcription, but can increase its rate by two- to three-fold.

 

  1. Principles of gene regulation

Pages: 1117-1118

The operator region normally can be bound by:

 

  1. suppressor tRNA.

 

  1. Principles of gene regulation

Pages: 1117-1118

Small signal molecules that regulate transcription are not known to:

 

  1. A) cause activator proteins to bind DNA sites.
  2. B) cause repressor proteins to bind DNA sites.
  3. C) directly bind to DNA sites.
  4. D) prevent activator proteins from binding to DNA sites.
  5. E) release repressor proteins from DNA sites.

 

 

  1. Principles of gene regulation

Pages: 1117-1119

The diagram below represents a hypothetical operon in the bacterium E. coli.  The operon consists of two structural genes (A and B), which code for the enzymes A-ase and B-ase, respectively, and also includes P (promoter) and O (operator) regions as shown.

 

When a certain compound (X) is added to the growth medium of E. coli, the separate enzymes A-ase and B-ase are both synthesized at a 50-fold higher rate than in the absence of X.  (X has a molecular weight of about 200.)  Which of the following statements is true of the operon decribed above?

 

  1. All four genes (A, B, O, and P) will be transcribed into an mRNA that will then be translated into four different proteins.
  2. The 3 end of the mRNA from the operon will correspond to the left end of the operon as drawn.
  3. The 5 end of the messenger from this operon will correspond to the right end of the operon as drawn.
  4. The repressor for this operon binds just to the right of A.
  5. When RNA polymerase makes mRNA from this operon, it begins RNA synthesis just to the left of gene A.

 

  1. Principles of gene regulation

Pages: 1117-1119            

The diagram below represents a hypothetical operon in the bacterium E. coli.  The operon consists of two structural genes (A and B) that code for the enzymes A-ase and B-ase, respectively, and also includes P (promoter) and O (operator) regions as shown.

 

When a certain compound (X) is added to the growth medium of E. coli, the separate enzymes A-ase and B-ase are both synthesized at a 50-fold higher rate than in the absence of X (which has a molecular weight of about 200).  Which one of the following statements is true of such an operon?

 

  1. Adding X to the growth medium causes a repressor protein to be released from the O region.
  2. Adding X to the growth medium causes a repressor protein to bind tightly to the O region.
  3. Synthesis of the mRNA from this operon is not changed by the addition of compound X.
  4. The mRNA copied from this operon will be covalently linked to a short piece of DNA at the 5
  5. Two mRNA molecules are made from this operon, one from gene A the other from gene B.

 

  1. Principles of gene regulation

Pages: 1119-1121            

Transcription of the lactose operon in E. coli is stimulated by:

 

  1. a mutation in the repressor gene that strengthens the affinity of the repressor for the operator.
  2. a mutation in the repressor gene that weakens the affinity of the repressor for the operator.
  3. a mutation in the repressor gene that weakens the affinity of the repressor for the inducer.
  4. binding of the repressor to the operator.
  5. the presence of glucose in the growth medium.

 

  1. Principles of gene regulation

Page: 1121                                   

Protein amino acid side chains can hydrogen bond in the major groove of DNA, and discriminate between each of the four possible base pairs.  In which one of the following groups of amino acids can all three members potentially be used in such DNA-protein recognition?

 

  1. Ala, Asn, Glu
  2. Arg, Gln, Leu
  3. Asn, Gln, Trp
  4. Asn, Glu, Lys
  5. Glu, Lys, Pro

 

  1. Principles of gene regulation

Pages: 1121-1123

The DNA binding motif for many prokaryotic regulatory proteins, such as the lac repressor, is:

 

  1. helix-turn-helix.
  2. leucine zipper.
  3. zinc finger.

 

  1. Principles of gene regulation

Pages: 1121-1124            

Protein structural motifs often have general functions in common.  Which one of the following motifs is known to be involved in protein dimer formation, but not in direct protein-DNA interactions?

 

  1. b-barrel
  2. helix-turn-helix
  3. homeodomain
  4. leucine zipper
  5. zinc finger

 

  1. Regulation of gene expression in prokaryotes

Pages: 1126-1127            

Which of the following statements about regulation of the lac operon is true?

 

  1. Glucose in the growth medium decreases the inducibility by lactose.
  2. Glucose in the growth medium does not affect the inducibility by lactose.
  3. Glucose in the growth medium increases the inducibility by lactose.
  4. Its expression is regulated mainly at the level of translation.
  5. The lac operon is fully induced whenever lactose is present.

 

 

 

 

  1. Regulation of gene expression in prokaryotes

Pages: 1126-1127                        

The binding of CRP (cAMP receptor protein of E. coli) to DNA in the lac operon:

 

  1. assists RNA polymerase binding to the lac
  2. is inhibited by a high level of cAMP.
  3. occurs in the lac repressor region.
  4. occurs only when glucose is present in the growth medium.
  5. prevents repressor from binding to the lac

 

  1. Regulation of gene expression in prokaryotes

Pages: 1126-1127                        

Consider the lac operon of E. coli.  When there is neither glucose nor lactose in the growth medium:

 

  1. CRP protein binds to the lac
  2. CRP protein displaces the Lac repressor from the lac
  3. repressor is bound to the lac
  4. RNA polymerase binds lac promoter and transcribes the lac
  5. the operon is fully induced.

 

  1. Regulation of gene expression in prokaryotes

Pages: 1126-1127                        

A regulon is a(n):

 

  1. group of related triplet codons.
  2. network of operons with a common regulator.
  3. operon that is subject to regulation.
  4. protein that regulates gene expression.
  5. ribosomal protein that regulates translation.

 

  1. Regulation of gene expression in prokaryotes

Pages: 1127-1128            

The tryptophan operon of E. coli is repressed by tryptophan added to the growth medium.  The tryptophan repressor probably:

 

  1. binds to RNA polymerase when tryptophan is present.
  2. binds to the trp operator in the absence of tryptophan.
  3. binds to the trp operator in the presence of tryptophan.
  4. is a DNA sequence.
  5. is an attenuator.

 

  1. Regulation of gene expression in prokaryotes

Pages: 1127-1130

Which one of the following statements about the transcription attenuation mechanism is true?

 

  1. In some operons (e.g., the his operon), attenuation may be the only regulatory mechanism.
  2. Sequences of the trp operon leader RNA resemble an operator.
  3. The leader peptide acts by a mechanism that is similar to that of a repressor protein.
  4. The leader peptide gene of the trp operon includes no Trp codons.
  5. The leader peptide is an enzyme that catalyzes transcription attenuation.

 

  1. Regulation of gene expression in prokaryotes

Pages: 1127-1130            

Which of the following statements is true of the attenuation mechanism used to regulate the tryptophan biosynthetic operon in E. coli?

 

  1. Attenuation is the only mechanism used to regulate the trp
  2. One of the enzymes in the Trp biosynthetic pathway binds to the mRNA and blocks translation when tryptophan levels are high.
  3. The leader peptide plays a direct role in causing RNA polymerase to attenuate transcription.
  4. Trp codons in the leader peptide gene allow the system to respond to tryptophan levels in the cell.
  5. When tryptophan levels are low, the trp operon transcripts are attenuated (halted) before the operon’s structural genes are transcribed.

 

  1. Regulation of gene expression in prokaryotes

Pages: 1127-1130            

Attenuation in the trp operon of E. coli:

 

  1. can adjust transcription of the structural genes upwards when tryptophan is present.
  2. can fine-tune the transcription of the operon in response to small changes in Trp availability.
  3. is a mechanism for inhibiting translation of existing (complete) trp
  4. results from the binding of the Trp repressor to the operator.
  5. results from the presence of short leader peptides at the 5 end of each structural gene.

 

  1. Regulation of gene expression in prokaryotes

Pages: 1130-1131            

RecA protein provides the functional link between DNA damage and the SOS response by displacing the LexA protein from its operator sites on the SOS genes.  RecA does so by:

 

  1. associating with polymerase holoenzyme to help it remove LexA from operator.
  2. bending LexA operator DNA to force dissociation of LexA repressor.
  3. binding to LexA protein to weaken directly its affinity for operator sites.
  4. causing self-cleavage of LexA, thus inactivating its binding to operator.
  5. competitively binding to LexA operators and serving as an activator.

 

  1. Regulation of gene expression in prokaryotes

Pages: 1131-1132            

An example of coordinate control is the down-regulation of ribosomal RNA synthesis in response to amino acid starvation, which will cause synthesis of ribosomal proteins to be limited.  What is the correct order of the following events that participate in the signaling process?

 

  1. Binding of stringent factor to the ribosome.
  2. Formation of the unusual nucleotide ppGpp.
  3. Formation of the unusual nucleotide pppGpp.
  4. Uncharged tRNA binds in the ribosomal A-site.

 

  1. 1, 4, 2, 3
  2. 1, 4, 3, 2
  3. 4, 1, 2, 3
  4. 4, 1, 3, 2
  5. 4, 2, 1, 3

 

  1. Regulation of gene expression in eukaryotes

Page: 1137-1138              

Which one of the following statements about eukaryotic gene regulation is correct?

 

  1. Large polycistronic transcripts are common.
  2. Most regulation is positive, involving activators rather than repressors.
  3. Transcription and translation are mechanistically coupled.
  4. Transcription does not involve promoters.
  5. Transcription occurs without major changes in chromosomal organization.

 

  1. Regulation of gene expression in eukaryotes

Pages: 1138-1139

Which of the following is a DNA sequence?

 

  1. Coactivator
  2. Corepressor
  3. Enhancer
  4. Inducer
  5. Transactivator

 

  1. Regulation of gene expression in eukaryotes

Pages: 1138-1139

Which one of the following types of eukaryotic regulatory proteins interact with enhancers?

 

  1. Basal transcription factors
  2. Coactivators
  3. Repressors
  4. TATA-binding proteins
  5. Transactivators

 

  1. Regulation of gene expression in eukaryotes

Page: 1142                                   

Which one of the following is not involved in steroid hormone action?

 

  1. Cell surface receptors
  2. Hormone-receptor complexes
  3. Specific DNA sequences
  4. Transcription activation and repression
  5. Zinc fingers

 

  1. Regulation of gene expression in eukaryotes

Page: 1145-1146                          

Gene silencing by RNA interference acts by                      of the target gene.

 

  1. inhibiting transcription
  2. inhibiting translation
  3. inhibiting splicing
  4. degradation of the mRNA
  5. inhibiting polyadenylyation

 

  1. Regulation of gene expression in eukaryotes

Page: 1147                                   

Which one of the following classes is expressed in the unfertilized egg and is involved in directing the spatial organization of the Drosophila embryo early in development?

 

  1. Gap genes
  2. Homeotic genes
  3. Maternal genes
  4. Segment polarity genes
  5. Segmentation genes

 

  1. Regulation of gene expression in eukaryotes

Pages: 1147, 1150-1152

Which one of the following classes of genes is involved in specifying the localization of organs in the Drosophila embryo?

 

  1. Gap genes
  2. Homeotic genes
  3. Maternal genes
  4. Segment polarity genes
  5. Segmentation genes

 

  1. Regulation of gene expression in eukaryotes

Pages: 1147, 1150-1152              

In the development of the fly Drosophila, homeotic genes:

 

  1. are transcribed during egg production; their mRNAs lie dormant in the egg until it is fertilized.
  2. determine the number of body segments that will form.
  3. are expressed late and determine the detailed structure of each body segment.
  4. generally have no introns.
  5. are not translated into proteins.

 

 

Short Answer Questions

 

  1. Principles of gene regulation

Page: 1117                       

Usually, a mutation in the promoter region of an operon causes reduced levels of synthesis of the proteins encoded by that operon.  Occasionally, a mutation in the promoter region actually causes increased levels of synthesis.  Can you suggest (briefly) a plausible explanation?

 

 

  1. Principles of gene regulation

Page: 1118                       

Describe and contrast positive regulation and negative regulation of gene expression.

 

 

  1. Principles of gene regulation

Pages: 1119         

Define operon and polycistronic mRNA.

 

 

  1. Principles of gene regulation

Pages: 1119-1121

Match the molecule with its role in the lac operon.  Note that a given molecule may have more than one role.

 

Molecule          Function

(a) galactose     (1) substrate of b-galactosidase enzyme

(b) glucose       (2) product of b-galactosidase enzyme

(c) IPTG           (3) inducer of lac operon

(d) lactose

 

 

  1. Principles of gene regulation

Pages: 1122-1125

Match the protein or structural feature on the left with one appropriate description on the right.

 

____ activator                  (a) a positive regulator

____ helix-turn-helix       (b) a negative regulator

____ leucine zipper          (c) facilitates transcription only when bound to a signal

____ repressor                      molecule

____ zinc finger               (d) a DNA-binding structural motif found in many

prokaryotic regulatory proteins

(e) a structural feature involved in protein-protein interactions

between some regulatory protein monomers

(f) a protein that dissociates from DNA when bound to a

signal molecule

(g) a DNA-binding structural motif found in many eukaryotic

regulatory proteins

 

  1. Regulation of gene expression in prokaryotes

Pages: 1119-1120, 1126-1127

  1. coli cells are placed in a growth medium containing lactose. Indicate how the following circumstances would affect the expression of the lactose operon (increase/decrease/no change).
  • Addition of high levels of glucose
  • A Lac repressor mutation that prevents dissociation of Lac repressor from the operator
  • A mutation that inactivates b-galactosidase
    • A mutation that inactivates galactoside permease
    • A mutation that prevents binding of CRP to its binding site near the lac promoter

 

 

  1. Regulation of gene expression in prokaryotes

Pages: 1120, 1126-1127

Draw a simple map of the lactose operon indicating the relative positions of promoter, operator, CRP-binding site, repressor gene (I), and the structural genes of the operon (A, Y, Z).  Indicate where the CRP protein binds within this operon.  When it is bound to this site, does the CRP protein have a positive or negative effect on gene expression in this system?

 

 

  1. Regulation of gene expression in prokaryotes

Pages: 1126-1127

Briefly explain (a) why there is a lag in cell growth when bacteria are switched from a medium containing glucose to one containing lactose.  (b) When the growth medium contains both lactose and glucose, what proteins will be bound to the lac operon regulatory region?  (c) If only lactose is in the growth medium, what proteins will be bound to the lac operon regulatory region?

 

  1. Regulation of gene expression in prokaryotes

Pages: 1127-1129 Difficutly: 3

In prokaryotes such as E. coli, many operons that encode enzymes involved in amino acid biosynthesis begin with a sequence coding for a leader peptide.  This peptide has no known enzymatic function and is rich in the amino acid that is synthesized by the enzymes coded for in the operon.  What is the function of this leader peptide?

 

 

  1. Regulation of gene expression in prokaryotes

Page: 1130-1131  

The SOS response in E. coli is triggered by extensive damage to the cell’s DNA and increases the capacity for repairing such DNA.  What molecular events bring about expression of the SOS genes?

 

 

  1. Regulation of gene expression in prokaryotes

Pages: 1131-1132

Explain how synthesis of ribosomal proteins in E. coli is regulated at the level of translation.

 

 

  1. Regulation of gene expression in prokaryotes

Pages: 1126-1135

Match each of the operons with the type(s) of regulation present in that operon.  Note that a given type can be used more than once, or not at all; also, a given operon may have more than one type of regulation.

 

Operon                        Type or Regulation

(a) lac              (1) activation

(b) trp              (2) repression

(c) SOS                        (3) attenuation

(4) DNA rearrangement

 

  1. Regulation of gene expression in eukaryotes

Pages: 1136-1137

Describe briefly the relationship between chromatin structure and transcription in eukaryotes.

 

 

 

  1. Regulation of gene expression in eukaryotes

Pages: 1136-1139

Define each in about two sentences:  (a) hypersensitive sites in eukaryotic chromosomes; (b) enhancers (upstream activator sequences); (c) chromatin remodeling.

 

 

  1. Regulation of gene expression in eukaryotes

Page: 1139                       

Describe in one or two sentences the role of each of the following types of proteins in the regulation of gene expression in eukaryotes:  (a) basal transcription factors; (b) transactivators; (c) coactivators.

 

 

  1. Regulation of gene expression in eukaryotes

Pages: 1141-1142

DNA-binding transactivating proteins often possess a domain separate from their DNA-binding domains that serves as a docking site for interactions with the transcription complex, coactivators, corepressors, or even chromatin remodeling proteins, to regulate gene transcription.  Describe three known kinds of such domains, and provide an example of each.

 

  1. Regulation of gene expression in eukaryotes

Pages: 1142-1144

Describe briefly the process by which steroid hormones affect gene expression.

 

  1. Regulation of gene expression in eukaryotes

Pages: 1144-1145            

What are three mechanisms of translational repression that are known to exist in eukaryotes?

 

 

  1. Regulation of gene expression in eukaryotes

Pages: 1145-1146

Large numbers of micro-RNAs (miRNAs), also known as small temporal RNAs (stRNAs) have now been discovered in higher eukaryotes.  Describe their characteristics and general function.

 

 

  1. Regulation of gene expression in eukaryotes

Pages: 1146-1152

Describe briefly the general role of the protein products of each of the following types of genes in the embryonic development of the Drosophila:  (a) maternal genes; (b) segmentation genes; (c) homeotic genes.